A functional serotonin transporter promoter polymorphism, HTTLPR, alters the risk of disease as well as brain morphometry and function. Here, we show that HTTLPR is functionally triallelic. The LG allele, which is the L allele with a common G substitution, creates a functional AP2 transcription-factor binding site. Expression assays in 62 lymphoblastoid cell lines representing the six genotypes and in transfected raphe-derived cells showed codominant allele action and low, nearly equivalent expression for the S and LG alleles, accounting for more variation in HTT expression than previously recognized. The gain-of-function LALA genotype was approximately twice as common in 169 whites with obsessive-compulsive disorder (OCD) than in 253 ethnically matched controls. We performed a replication study in 175 trios consisting of probands with OCD and their parents. The LA allele was twofold overtransmitted to the patients with OCD. The HTTLPR LALA genotype exerts a moderate (1.8-fold) effect on risk of OCD, which crystallizes the evidence that the HTT gene has a role in OCD. A functional serotonin transporter promoter polymorphism, HTTLPR, alters the risk of disease as well as brain morphometry and function. Here, we show that HTTLPR is functionally triallelic. The LG allele, which is the L allele with a common G substitution, creates a functional AP2 transcription-factor binding site. Expression assays in 62 lymphoblastoid cell lines representing the six genotypes and in transfected raphe-derived cells showed codominant allele action and low, nearly equivalent expression for the S and LG alleles, accounting for more variation in HTT expression than previously recognized. The gain-of-function LALA genotype was approximately twice as common in 169 whites with obsessive-compulsive disorder (OCD) than in 253 ethnically matched controls. We performed a replication study in 175 trios consisting of probands with OCD and their parents. The LA allele was twofold overtransmitted to the patients with OCD. The HTTLPR LALA genotype exerts a moderate (1.8-fold) effect on risk of OCD, which crystallizes the evidence that the HTT gene has a role in OCD. The serotonin transporter strongly modulates serotonin function and is a major therapeutic target in several psychiatric diseases, including anxiety, depression, and obsessive-compulsive disorder (OCD [MIM 164230]). HTTLPR, a functional polymorphism of the 5′ flanking region of the serotonin transporter gene (called HTT, SLC6A4, or SERT),1Heils A Teufel A Petri S Seemann M Bengel D Balling U Riederer P Lesch KP Functional promoter and polyadenylation site mapping of the human serotonin (5-HT) transporter gene.J Neural Transm Gen Sect. 1995; 102: 247-254Crossref PubMed Scopus (226) Google Scholar is an intensively studied locus. More than 300 studies have investigated the role of HTTLPR in diverse neuropsychiatric phenotypes.2Glatt CE Freimer NB Association analysis of candidate genes for neuropsychiatric disease: the perpetual campaign.Trends Genet. 2002; 18: 307-312Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar Recently, HTTLPR was shown to determine the neuroanatomical size and functional coupling of the amygdala-frontal cortical circuit that has been directly implicated in a variety of psychiatric disorders, including OCD. The focus of these imaging genetics studies was the S allele, which leads to reduced gray matter volume in limbic regions and disrupted amygdala-cingulate coupling after emotional stimuli.3Heinz A Braus DF Smolka MN Wrase J Puls I Hermann D Klein S Grusser SM Flor H Schumann G Mann K Buchel C Amygdala-prefrontal coupling depends on a genetic variation of the serotonin transporter.Nat Neurosci. 2005; 8: 20-21Crossref PubMed Scopus (583) Google Scholar, 4Pezawas L Meyer-Lindenberg A Drabant EM Verchinski BA Munoz KE Kolachana BS Egan MF Mattay VS Hariri AR Weinberger DR 5-HTTLPR polymorphism impacts human cingulate-amygdala interactions: a genetic susceptibility mechanism for depression.Nat Neurosci. 2005; 8: 828-834Crossref PubMed Scopus (1551) Google Scholar Conversely, the gain-of-function L allele had the opposite effect, an effect potentially relevant to OCD for which hyperfrontality has been observed in functional neuroimaging studies.5Ursu S Stenger VA Shear MK Jones MR Carter CS Overactive action monitoring in obsessive-compulsive disorder: evidence from functional magnetic resonance imaging.Psychol Sci. 2003; 14: 347-353Crossref PubMed Scopus (278) Google Scholar HTTLPR has been considered functionally biallelic, even though other genetic variations were known. HTTLPR consists of varying numbers of copies of a 20–23-bp imperfect repeat sequence. Among white individuals, the frequency of the L allele (16 repeats) is ∼0.60, and the frequency of the S allele (14 repeats) is ∼0.40.6Lesch KP Bengel D Heils A Sabol SZ Greenberg BD Petri S Benjamin J Muller CR Hamer DH Murphy DL Association of anxiety-related traits with a polymorphism in the serotonin transporter gene regulatory region.Science. 1996; 274: 1527-1531Crossref PubMed Scopus (4222) Google Scholar Substantial interpopulation variation occurs. Rare alleles contain up to 20 copies of the repeat.7Delbruck SJ Wendel B Grunewald I Sander T Morris-Rosendahl D Crocq MA Berrettini WH Hoehe MR A novel allelic variant of the human serotonin transporter gene regulatory polymorphism.Cytogenet Cell Genet. 1997; 79: 214-220Crossref PubMed Scopus (59) Google Scholar Single-nucleotide variants have been detected within HTTLPR,8Nakamura M Ueno S Sano A Tanabe H The human serotonin transporter gene linked polymorphism (5-HTTLPR) shows ten novel allelic variants.Mol Psychiatry. 2000; 5: 32-38Crossref PubMed Scopus (495) Google Scholar including an A→G SNP that will be extensively discussed below. However, none of these additional alleles was found to be functional, although several (including the A→G SNP) were tested in transfected mammalian cells. HTTLPR was therefore treated as biallelic in linkage studies. Concerning function, the S allele leads to lower expression of HTT mRNA and lower expression of serotonin transporter in membranes.6Lesch KP Bengel D Heils A Sabol SZ Greenberg BD Petri S Benjamin J Muller CR Hamer DH Murphy DL Association of anxiety-related traits with a polymorphism in the serotonin transporter gene regulatory region.Science. 1996; 274: 1527-1531Crossref PubMed Scopus (4222) Google Scholar, 9Heils A Teufel A Petri S Stober G Riederer P Bengel D Lesch KP Allelic variation of human serotonin transporter gene expression.J Neurochem. 1996; 66: 2621-2624Crossref PubMed Scopus (1907) Google Scholar Furthermore, the S allele appears to have a dominant mode of action,6Lesch KP Bengel D Heils A Sabol SZ Greenberg BD Petri S Benjamin J Muller CR Hamer DH Murphy DL Association of anxiety-related traits with a polymorphism in the serotonin transporter gene regulatory region.Science. 1996; 274: 1527-1531Crossref PubMed Scopus (4222) Google Scholar, 9Heils A Teufel A Petri S Stober G Riederer P Bengel D Lesch KP Allelic variation of human serotonin transporter gene expression.J Neurochem. 1996; 66: 2621-2624Crossref PubMed Scopus (1907) Google Scholar an observation that leads to the grouping of SS and SL genotypes in many but not all linkage studies.10Caspi A Sugden K Moffitt TE Taylor A Craig IW Harrington H McClay J Mill J Martin J Braithwaite A Poulton R Influence of life stress on depression: moderation by a polymorphism in the 5-HTT gene.Science. 2003; 301: 386-389Crossref PubMed Scopus (5912) Google Scholar, 11Hariri AR Mattay VS Tessitore A Kolachana B Fera F Goldman D Egan MF Weinberger DR Serotonin transporter genetic variation and the response of the human amygdala.Science. 2002; 297: 400-403Crossref PubMed Scopus (1865) Google Scholar In studies in vivo, the L allele has been associated with higher levels of HTT in platelets, postmortem brain,12Little KY McLaughlin DP Zhang L Livermore CS Dalack GW McFinton PR DelProposto ZS Hill E Cassin BJ Watson SJ Cook EH Cocaine, ethanol, and genotype effects on human midbrain serotonin transporter binding sites and mRNA levels.Am J Psychiatry. 1998; 155: 207-213Crossref PubMed Scopus (58) Google Scholar and living brain.12Little KY McLaughlin DP Zhang L Livermore CS Dalack GW McFinton PR DelProposto ZS Hill E Cassin BJ Watson SJ Cook EH Cocaine, ethanol, and genotype effects on human midbrain serotonin transporter binding sites and mRNA levels.Am J Psychiatry. 1998; 155: 207-213Crossref PubMed Scopus (58) Google Scholar, 13Heinz A Jones DW Mazzanti C Goldman D Ragan P Hommer D Linnoila M Weinberger DR A relationship between serotonin transporter genotype and in vivo protein expression and alcohol neurotoxicity.Biol Psychiatry. 2000; 47: 643-649Abstract Full Text Full Text PDF PubMed Scopus (402) Google Scholar, 14Greenberg BD Tolliver TJ Huang SJ Li Q Bengel D Murphy DL Genetic variation in the serotonin transporter promoter region affects serotonin uptake in human blood platelets.Am J Med Genet. 1999; 88: 83-87Crossref PubMed Scopus (470) Google Scholar Recently, an uncommon HTT variant, Val425,15Ozaki N Goldman D Kaye WH Plotnicov K Greenberg BD Lappalainen J Rudnick G Murphy DL Serotonin transporter missense mutation associated with a complex neuropsychiatric phenotype.Mol Psychiatry. 2003; 8 (933-936): 895Crossref Scopus (62) Google Scholar which leads to gain of function,16Kilic F Murphy DL Rudnick G A human serotonin transporter mutation causes constitutive activation of transport activity.Mol Pharmacol. 2003; 64: 440-446Crossref PubMed Scopus (120) Google Scholar was linked to severe behavioral problems (treatment-resistant OCD, anorexia nervosa, and Asperger syndrome) in two families.15Ozaki N Goldman D Kaye WH Plotnicov K Greenberg BD Lappalainen J Rudnick G Murphy DL Serotonin transporter missense mutation associated with a complex neuropsychiatric phenotype.Mol Psychiatry. 2003; 8 (933-936): 895Crossref Scopus (62) Google Scholar In particular, six patients with OCD in these families all carried the Val425 allele.15Ozaki N Goldman D Kaye WH Plotnicov K Greenberg BD Lappalainen J Rudnick G Murphy DL Serotonin transporter missense mutation associated with a complex neuropsychiatric phenotype.Mol Psychiatry. 2003; 8 (933-936): 895Crossref Scopus (62) Google Scholar These results suggested that the search for functional variation in HTT should be extended and that gain-of-function variants might be linked to OCD. Genomic DNA was extracted from 2,998 individuals, including 624 African Americans (414 with drug addictions and 210 with no psychiatric diagnosis), 771 Finnish whites (480 with various psychiatric diagnoses and 291 with no psychiatric disorders), 297 U.S. whites (group 1: 177 with various psychiatric diagnoses and 120 with no psychiatric disorders), 286 U.S. whites (group 2: 154 with various psychiatric diagnoses and 132 with no psychiatric disorders), 456 American Plains Indians (a community-representative sample including 335 individuals with psychiatric diagnoses and 121 with no psychiatric diagnosis), and 564 Southwest Indians (a community-representative sample including 359 with psychiatric disorders and 205 with no psychiatric diagnosis). Allele and genotype frequencies in the patients and controls in these populations did not differ. Presumably, this is because of the clinical heterogeneity and the lack of any strong HTTLPR effect on risk for the common but probably general diagnostic categories, such as alcoholism and anxiety disorders. Therefore, overall frequencies were computed. Human subjects were studied under human research protocols approved by the Rutgers University School of Medicine, the National Institute on Alcohol Abuse and Alcoholism (NIAAA), and the University of Helsinki. All participants gave informed consent for genetic studies on psychiatric disease. Subjects were interviewed for psychiatric traits with either the Structured Clinical Interview for DSM-IV (SCID) or the Schedule for Affective Disorders and Schizophrenia–Lifetime (SADS-L), and diagnoses were made according to DSM-IIIR criteria. Under a human research protocol approved by the National Institute of Mental Health (NIMH) Institutional Review Board (IRB), 169 patients with OCD and 253 controls without psychiatric disorders were ascertained at the NIMH. All participants gave informed consent. All participants were interviewed with the SCID, and diagnoses were made using DSM-IIIR criteria. The OCD sample was white and consisted of 97 males and 72 females, with an average age of 41.7 years. The control sample included 137 males and 116 females, with an average age of 39.9 years. A total of 581 individuals were ascertained, including 175 OCD-affected child-parents trios, at the Centre for Addiction and Mental Health, Toronto, under a human research protocol approved by that institution's IRB. All participants gave informed consent. Probands were recruited from consecutive referrals to the Anxiety Disorders Clinic. All participants were assessed using the SCID and the Yale-Brown Obsessive Compulsive Scale17Goodman WK Price LH Rasmussen SA Mazure C Fleischmann RL Hill CL Heninger GR Charney DS The Yale-Brown Obsessive Compulsive Scale. I. Development, use, and reliability.Arch Gen Psychiatry. 1989; 46: 1006-1011Crossref PubMed Scopus (5639) Google Scholar by trained interviewers. All information obtained was reviewed by a psychiatrist (M.A.R.) experienced in the diagnosis and treatment of OCD and related conditions, to insure diagnostic accuracy in using DSM-IV criteria. Only probands with confirmed OCD were included. Exclusion criteria included lifetime history of neurological or metabolic disease, bipolar disorder, psychotic disorder, or substance dependence. The transmission/disequilibrium test (TDT) was performed using complete parents-child trios and without regard for the affection status of parents. The TDT sample included 556 whites, 11 Hispanics, and 14 Asians. The probands comprised 69 males and 96 females, with an average age of 38.2 years. There were a total of 86 transmissions from heterozygous parents. Oligonucleotide primers and dye-labeled probes were designed to optimize allele discrimination by use of Primer Express software (Applied Biosystems). The L amplicon was 182 bp, and the S amplicon was 138 bp. Genotyping was accomplished in two stages. Stage 1 distinguished S from L alleles. Stage 2 distinguished LA from LG alleles. We used a total of four fluorogenic probes, two probes for each stage. For stage 1, the allele-discriminating probe (ADP) was capable of hybridizing once, and once only, to the 43-bp L insertion, and an internal control probe (ICP) hybridized to a sequence located within the same amplicon but specific to a divergent repeat found only once in the amplicon and not involved in the insertion/deletion. For stage 2, probes were designed that were specific to the LA and LG alleles. The fluorogenic probes were labeled at the 5′ end with either FAM or VIC (table 1).Table 1Primers and Probes for Two-Stage 5′-Exonuclease Genotyping of HTTLPR AllelesPrimers (5′→3′)HTTLPRAllelesForwardReverseProbes (5′→3′)S vs. LGCAACCTCCCAGCAACTCCCTGTAGAGGTGCAGGGGGATGCTGGAA6FAM-TGCAGCCCCCCCAGCATCTCCC-MGBVIC-TCCCCCCCTTCACCCCTCGCGGCATCC-MGBLA vs. LGGCAACCTCCCAGCAACTCCCTGTAGAGGTGCAGGGGGATGCTGGAALA: 6FAM-CCCCCCTGCACCCCCAGCATCCC-MGBLG: VIC-CCCCTGCACCCCCGGCATCCCC-MGB Open table in a new tab PCR was performed in a 25-μl volume, with 25–50 ng DNA, 120 nM ADP, 80 nM ICP, PCR primers (100 nM of each), dimethyl sulfoxide (DMSO) (4% by volume), and 1× Master Mix (ABI). Amplification conditions were 2 min at 50°C, 10 min at 95°C, and then 40 cycles at 96°C for 15 s and at 62.5°C for 90 s. Genotypes were generated using ABI PRISM 7700 Sequence Detection system software. Stage 1 and stage 2 genotypes were combined to assign samples to one of six genotypes: SS, SLA, SLG, LALA, LALG, and LGLG. On each plate, previously sequenced standards were introduced. Stage 1 standards were SS, LS, and LL, and stage 2 standards were LALA, LALG, and LGLG. To evaluate genotyping accuracy, one-quarter of the samples, randomly selected, were genotyped in duplicate. The error rate was <0.005, and the completion rate was >0.95. Genomic DNA was extracted from 106 lymphoblastoid cell lines derived from U.S. white controls. A 528-bp amplification product containing the entire HTTLPR region (L allele) was generated using a “touch-down” PCR procedure. Reaction mixtures contained 100 ng of genomic DNA; 0.2 mM each of dATP, dCTP, and dTTP; 0.1 mM dGTP; 0.1 mM 7-deaza-2′-dGTP; 0.4 μM of each primer; 10 mM Tris (pH 8.3); 50 mM KCl; 1.5 mM MgCl2; 4% DMSO; and 1 U Taq DNA polymerase in a final volume of 25 μl. The reference sequence used to determine the genomic nucleotide positions and to design primers was National Center for Biotechnology Information (NCBI) accession number AF126506. The forward primer was 5′-GGCGTTGCCGCTCTGAATGC-3′, and the reverse primer was 5′-GAGGGACTGAGCTGGACAACCAC-3′. DNA was denatured at 95°C for 5 min. Annealing was at 63°C for 30 s for the first 2 cycles, at 62°C for 30 s for the next 2 cycles, and at 61°C for 30 s for another 36 cycles. Extension was consistently performed at 72°C for 1 min. PCR was terminated by extension at 72°C for 10 min. The products were purified using the MiniElute PCR Purification Kit (QIAGEN). Primers for bidirectional sequencing were the same as those used for PCR as described above. The 10-μl sequencing reaction mixture contained 4 μl BigDye Terminator RR Mix (ABI), 2.84 μl dH2O, 1.6 pmol of forward or reverse primer, and 3 μl of purified HTTLPR PCR amplicon. Cycle conditions for sequencing were 25 cycles consisting of denaturation at 96°C for 10 s, annealing at 50°C for 5 s, and extension at 60°C for 4 min. Sequencing reaction products were purified using Performa DTR (Edge BioSystems) columns, were dried, were diluted with 25% formamide (v/v), were denatured at 95°C for 5 min, and were analyzed on a 3100 Genetic Analyzer (ABI). HTT mRNA expression was measured in 62 lymphoblastoid cell lines derived from Finnish whites collected at the University of Helsinki as described above in “Human Subjects.” The 62 cell lines were from 30 males and 32 females, with an average age of 37.6 years. Donors included individuals with various psychiatric diagnoses; the most frequent were alcoholism, antisocial personality disorder, depression, and anxiety disorders. However, cell lines were selected for expression studies on the basis of genotype alone, because of substantial preexisting evidence that HTTLPR influences behavior and the vulnerability to psychiatric disease. Cells were cultured in 15-cm2 flasks with 4 ml RPMI (Roswell Park Memorial Institute medium) containing 25% fetal bovine serum, 2% 200-mM glutamine, and 1% gentamicin (5 mg/ml) at 37°C, with 5% CO2. After 48 h, 100 μM forskolin was added, and cell culture was terminated after 72 h. Cells were harvested by centrifugation at 2,300 rpm for 3 min at 4°C. Pellets were homogenized in 0.75 ml TRIzol (Invitrogen). Samples were incubated at room temperature for 5 min, were shaken vigorously for 1 min after 0.2 ml of chloroform was added, were held at room temperature for another 2.5 min, and then were incubated at −80°C for at least 1 h. The supernatant was transferred to 1.2-ml microfuge tubes (0.5 ml/tube) after centrifugation at 4,000 rpm for 15 min at 4°C, and a 53% volume of 100% ethanol was added. Then, samples were applied to RNeasy minicolumns (QIAGEN), and the manufacturer's protocol was followed. Total RNA concentration was measured spectrophotometrically, and samples were stored at −80°C for no more than 1 wk. One μg of total RNA was used to synthesize first-strand cDNA by use of the Cloned AMV First-Strand Synthesis Kit (Invitrogen) and the manufacturer's protocol. HTT mRNA was measured on an ABI PRISM 7700 Sequence Detection System. Primers and probes were designed on the basis of NCBI SLC6A4 cDNA reference sequence NM_001045. The forward primer was 5′-GAAACCCAATTGGCAGAAACTC-3′, and the reverse primer was 5′-GAAGATCTGAGCGGCTGCAT-3′. The intron-spanning probe was 6FAM-ATCCACACCCCTGTCT-MGBNGQ. The endogenous reference was 18S rRNA (ABI). The 25-μl real-time PCR volume included 12.5 μl TaqMan Universal PCR Master Mix, 1.25 μl of 20×HTT mix, 1.25 μl of 20× 18S mix, 2 μl of products from the first-strand cDNA synthesis, and 8 μl RNase-free water. The thermal cycling conditions were 40 cycles at 95°C for 15 s and at 60°C for 1 min. Amplification was followed by a hold at 50°C for 2 min and at 95°C for 10 min. HTT mRNA concentration was estimated by the difference between HTT Ct (the amplification cycle at which the signal exceeded the background) and 18S Ct, which yields an HTT:18S rRNA ratio and a relative HTT concentration, by use of the equation 2−ΔΔCt, because per-cycle amplification efficiency was almost equal to 100%. Each of the 62 cell lines was assayed in quadruplicate. Nuclear extracts containing AP2 were prepared from JEG-3 cells (GENEKA Biotechnology) and were stored at −80°C. For “supershift” experiments, recombinant AP2 (Promega) was used. Single-stranded, complementary, 26-bp oligonucleotide sequences corresponding to the HTTLPR LA and LG allele AP2-binding motifs were annealed to form double-stranded probes. For the LA allele, the oligonucleotide was 5′-gatcgaacacCCCCCaGCAggcccgt-3′ (the upper strand, with the binding site in capital letters and the LA allele shown as a lower-case “a” within the binding site). For the LG allele, the oligonucleotide was 5′-gatcgaacacCCCCCgGCAggcccgt-3′ (with the LG allele shown as a lower-case “g” within the binding site). The “consensus” AP2 oligonucleotide was 5′-gatcgaactgaccGCCCGCGGCccgt-3′ (Promega) and was based on the consensus AP2-binding site (5′-GCCNNNGGC-3′). The AP2 antibody for the “supershift” assay was from GENEKA Biotechnology. [γ-33P]-ATP (Perkin-Elmer Life Science) probes for gel-shift assays were generated by labeling double-stranded oligonucleotides with T4 polynucleotide kinase (Promega) after annealing the complementary oligonucleotide and purifying it through a Bio-Spin 30 chromatography column (Bio-Rad). Binding assays were performed for 20 min at room temperature by use of 2 μl nuclear extract (10 μg total protein) in 15-μl reactions containing binding buffer (10 mM HEPES [N-2-hydroxyethylpiperazine-N′-2-ethanesulfonic acid; pH 7.8], 50 mM KCl, 5 mM MgCl2, 1 mM EDTA, and 5% glycerol), 1 mM dithiothreitol, 0.25 μg poly[dI:dC], and 0.2 μl radiolabeled probe (1.75 pmol; 100,000 cpm/μl). In competition experiments, unlabeled competitor (50× molar excess) was included with the nuclear extract for 10 min before the addition of labeled probe. In the “supershift” experiments, specific antibody was incubated with AP2 for 25 min at room temperature, after probe addition. Complexes were separated on a Novex 6% DNA retardation gel (0.5× Tris-borate-EDTA) at 300 V for 16 min at room temperature. Gels were dried and exposed to x-ray film for 12 h. Genomic DNA samples with S, LG, or LA alleles were selected for PCR-based cloning of HTTLPR. PCR primers and conditions were the same as for resequencing. The PCR products (529 bp for LG and LA; 486 bp for S) were cloned into pCR-TOPO vector (Invitrogen) and then were subcloned into pGL4.10 (Promega) by standard molecular techniques. Sequences of inserts were confirmed by direct sequence analysis using M13 forward and reverse primers. The RN46A raphe-derived cell line was generously provided by Scott R. Whittemore (University of Louisville School of Medicine) and was maintained in Dulbecco's modified Eagle medium (DMEM) and Ham's F12 (1:1 v/v) with 5% fetal calf serum at 33°C in a humidified incubator (95% air, 5% CO2). RN46A cells were seeded at a density of 2×105 cells per well into a 12-well tissue-culture plate. When the cells were 90% confluent, the HTTLPR-pGL4.10 (firefly luciferase) and pRL-SV40 (Renilla luciferase) constructs were cotransfected using Lipofectamine 2000 (Invitrogen). For AP2 transcription-factor competition experiments, a double-stranded decoy DNA was also cotransfected. Sequences used to prepare the LG and LA decoy DNAs were identical to those used for gel-shift assay probes. The cells were harvested for the Dual-Luciferase Reporter Assay System (Promega) by passive lysis buffer 24 h after transfection. The activities of both firefly luciferase and Renilla luciferase were quantified as relative light units (RLU). Each of the three HTTLPR-pGL4.10 constructs or an empty pGL4.10 plasmid was transfected in triplicate. The ratio of firefly RLU to Renilla RLU in a sample from each well was determined, and the values were normalized to the S allele. HTT allele and genotype expression values were computed by multiple regression using data from 62 lymphoblastoid cell lines (7–15 cell lines per genotype). Genotype-specific expression was estimated assuming codominance (i.e., additive effects of alleles in a genotype). To test for dominance and/or recessivity, these predicted genotype expression values were compared, by linear regression, with the expression observed in the cell lines. Analysis of variance was used to calculate genotype-attributable variance. Association with OCD was evaluated using χ2 and logistic regression analyses. First, association was tested using the information that LA is a high-expressing allele and by combining the S and LG alleles, which are low and closely equivalent in expression. Thus, there were again three genotypes. Second, linkage was evaluated using HTT expression scores predicted by genotype. A common single-base substitution (A→G) occurs at the sixth nucleotide within the first of two extra 20–23-bp repeats in the L allele (fig. 1). The two L alleles LA and LG, together with the S allele, comprise a triallelic locus. The A→G substitution is located 1,629 bp upstream of the transcription start site (fig. 2A) and was genotyped in the second step of a two-stage 5′-nuclease assay for the triallelic locus. LG corresponds to 1 of 10 SNPs detected within HTTLPR by Nakamura et al.8Nakamura M Ueno S Sano A Tanabe H The human serotonin transporter gene linked polymorphism (5-HTTLPR) shows ten novel allelic variants.Mol Psychiatry. 2000; 5: 32-38Crossref PubMed Scopus (495) Google Scholar (fig. 2A and 2B). The alleles corresponding to LA and LG were designated “ζ” and “μ” by those investigators. In several populations, all three alleles are abundant or highly abundant, as will be described below. Other novel alleles detected by Nakamura et al.8Nakamura M Ueno S Sano A Tanabe H The human serotonin transporter gene linked polymorphism (5-HTTLPR) shows ten novel allelic variants.Mol Psychiatry. 2000; 5: 32-38Crossref PubMed Scopus (495) Google Scholar were rare, and we did not observe them, even though we resequenced the HTTLPR region in 106 clinically and ethnically diverse individuals.Figure 2A, Sequence and organization of HTTLPR repeats. Sequences from −1797 to −1268 relative to the HTT transcription start site are shown. This segment, encompassing the HTTLPR region, was inserted into the pGL4.10 expression plasmid. PCR primers used for genomic amplification are indicated in underlined lower-case letters. AP2 sites are boxed. Capital letters indicate the 43-bp insertion containing the A→G SNP, which is in brackets. Previously, this region was considered to be a 44-bp insertion/deletion, because of an additional C in the reference sequence (NCBI accession number AF116506). This region of sequence disparity is shown in bold letters (five Cs). Our sequencing results (106 samples) and those of Nakamura et al.8Nakamura M Ueno S Sano A Tanabe H The human serotonin transporter gene linked polymorphism (5-HTTLPR) shows ten novel allelic variants.Mol Psychiatry. 2000; 5: 32-38Crossref PubMed Scopus (495) Google Scholar and Kraft et al.18Kraft JB Slager SL McGrath PJ Hamilton SP Sequence analysis of the serotonin transporter and associations with antidepressant response.Biol Psychiatry. 2005; 58: 374-381Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar confirm the sequence presented. A rare substitution within this region (C→T; frequency 0.0048 in present study and 0.007 in study by Nakamura et al.) is underlined. B, HTTLPR LA and LG alleles detected by direct sequencing. Representative electropherograms show the position of the A→G SNP (arrows).View Large Image Figure ViewerDownload Hi-res image Download (PPT) Using a two-stage 5′-nuclease assay, we determined triallelic HTTLPR genotypes and allele frequencies in five populations, comprising 2,998 total individuals: 624 African Americans, 771 Finnish whites, 583 U.S. whites, 456 Plains Indians, and 564 Southwest Indians. The Southwest Indians, Plains Indians, and Finnish whites are populations that are relatively nonadmixed. The frequency of S was lowest in individuals of African descent (0.25), was intermediate in whites (0.35–0.40), and was highest in American Indians (0.64–0.66). The S:LA:LG ratio was 4:5:1 in whites, 2.5:5:2.5 in African Americans, and 2:1:0 in American Indians (i.e., the LG allele was nearly absent in both American Indian populations) (table 2).Table 2Distribution of HTTLPR Genotype and Allele Frequencies in Several PopulationsFrequency of GenotypeFrequency of AllelePopulationNSSSLASLGLALALALGLGLGSLALGFinnish whites771.15.44.08.24.09.01.40.51.09U.S. whites group 1297.16.33.09.26.14.03.37.49.14U.S. whites group 2286.12.37.08.22.18.02.35.50.15Plains Indians456.42.47.01.09.01.00.66.33.01Southwest Indians564.42.43.01.13.01.00.64.35.01African Americans624.07.25.12.27.23.06.25.51.24 Open table in a new tab
