Integrated Glycoproteomics Identifies a Role of N-Glycosylation and Galectin-1 on Myogenesis and Muscle Development

Abstract

•Proteomic, glycomic and glycoproteomic analysis of myogenesis.•Mechanistic insights into site-specific glycoproteome regulation via discrete glycosidases and glycosyltransferases.•Quantification and validation of glycan-binding proteins.•Functional analysis of LGALS1 reveals a role in myogenesis and muscle development. Many cell surface and secreted proteins are modified by the covalent addition of glycans that play an important role in the development of multicellular organisms. These glycan modifications enable communication between cells and the extracellular matrix via interactions with specific glycan-binding lectins and the regulation of receptor-mediated signaling. Aberrant protein glycosylation has been associated with the development of several muscular diseases, suggesting essential glycan- and lectin-mediated functions in myogenesis and muscle development, but our molecular understanding of the precise glycans, catalytic enzymes, and lectins involved remains only partially understood. Here, we quantified dynamic remodeling of the membrane-associated proteome during a time-course of myogenesis in cell culture. We observed wide-spread changes in the abundance of several important lectins and enzymes facilitating glycan biosynthesis. Glycomics-based quantification of released N-linked glycans confirmed remodeling of the glycome consistent with the regulation of glycosyltransferases and glycosidases responsible for their formation including a previously unknown digalactose-to-sialic acid switch supporting a functional role of these glycoepitopes in myogenesis. Furthermore, dynamic quantitative glycoproteomic analysis with multiplexed stable isotope labeling and analysis of enriched glycopeptides with multiple fragmentation approaches identified glycoproteins modified by these regulated glycans including several integrins and growth factor receptors. Myogenesis was also associated with the regulation of several lectins, most notably the upregulation of galectin-1 (LGALS1). CRISPR/Cas9-mediated deletion of Lgals1 inhibited differentiation and myotube formation, suggesting an early functional role of galectin-1 in the myogenic program. Importantly, similar changes in N-glycosylation and the upregulation of galectin-1 during postnatal skeletal muscle development were observed in mice. Treatment of new-born mice with recombinant adeno-associated viruses to overexpress galectin-1 in the musculature resulted in enhanced muscle mass. Our data form a valuable resource to further understand the glycobiology of myogenesis and will aid the development of intervention strategies to promote healthy muscle development or regeneration. Many cell surface and secreted proteins are modified by the covalent addition of glycans that play an important role in the development of multicellular organisms. These glycan modifications enable communication between cells and the extracellular matrix via interactions with specific glycan-binding lectins and the regulation of receptor-mediated signaling. Aberrant protein glycosylation has been associated with the development of several muscular diseases, suggesting essential glycan- and lectin-mediated functions in myogenesis and muscle development, but our molecular understanding of the precise glycans, catalytic enzymes, and lectins involved remains only partially understood. Here, we quantified dynamic remodeling of the membrane-associated proteome during a time-course of myogenesis in cell culture. We observed wide-spread changes in the abundance of several important lectins and enzymes facilitating glycan biosynthesis. Glycomics-based quantification of released N-linked glycans confirmed remodeling of the glycome consistent with the regulation of glycosyltransferases and glycosidases responsible for their formation including a previously unknown digalactose-to-sialic acid switch supporting a functional role of these glycoepitopes in myogenesis. Furthermore, dynamic quantitative glycoproteomic analysis with multiplexed stable isotope labeling and analysis of enriched glycopeptides with multiple fragmentation approaches identified glycoproteins modified by these regulated glycans including several integrins and growth factor receptors. Myogenesis was also associated with the regulation of several lectins, most notably the upregulation of galectin-1 (LGALS1). CRISPR/Cas9-mediated deletion of Lgals1 inhibited differentiation and myotube formation, suggesting an early functional role of galectin-1 in the myogenic program. Importantly, similar changes in N-glycosylation and the upregulation of galectin-1 during postnatal skeletal muscle development were observed in mice. Treatment of new-born mice with recombinant adeno-associated viruses to overexpress galectin-1 in the musculature resulted in enhanced muscle mass. Our data form a valuable resource to further understand the glycobiology of myogenesis and will aid the development of intervention strategies to promote healthy muscle development or regeneration. The bulk of skeletal muscle is composed of postmitotic multinucleated myofibers that form via the fusion of mononucleated progenitor myoblasts. Myofiber formation is achieved via myogenesis, a highly ordered process including differentiation, elongation, migration, cell adhesion, membrane alignment, and ultimately cell fusion of myoblasts (1Dittmar T. Zanker K.S. Cell fusion in health and disease. Volume II: cell fusion in disease. Introduction.Adv. Exp. Med. Biol. 2011; 714: 1-3PubMed Google Scholar). The initial differentiation of myoblasts is regulated by external growth factors, cytokines, steroid hormones, and signal transduction pathways that activate a series of muscle-specific and pleiotropic transcription factors (2Braun T. Gautel M. Transcriptional mechanisms regulating skeletal muscle differentiation, growth and homeostasis.Nat. Rev. Mol. Cell Biol. 2011; 12: 349-361Crossref PubMed Scopus (366) Google Scholar). Elongation of myoblasts is achieved by extension of filopodia and lamellipodia to contact surrounding muscle cells. Myoblasts subsequently migrate to each other, which requires extracellular matrix (ECM) remodeling to facilitate cell motility before cell recognition and adherence. Here, interactions between multiple adherence molecules trigger integrin signaling and a rearrangement of the actin-cytoskeleton. This is coupled to the regulation of several GTPases and guanine nucleotide exchange factors that contribute to membrane remodeling and cell fusion via the ARP2/3, WASP, and WAVE protein complexes (3Kim J.H. Jin P. Duan R. Chen E.H. Mechanisms of myoblast fusion during muscle development.Curr. Opin. Genet. Dev. 2015; 32: 162-170Crossref PubMed Scopus (129) Google Scholar). In mammals, distinct phases of myogenesis contribute to the formation of mature skeletal muscle (4Kablar B. Rudnicki M.A. Skeletal muscle development in the mouse embryo.Histol. Histopathol. 2000; 15: 649-656PubMed Google Scholar, 5Schiaffino S. Dyar K.A. Ciciliot S. Blaauw B. Sandri M. Mechanisms regulating skeletal muscle growth and atrophy.FEBS J. 2013; 280: 4294-4314Crossref PubMed Scopus (682) Google Scholar). Muscle patterning is established by the fusion of embryonic myoblasts. The second phase involves fusion of fetal myoblasts followed by the formation of the basal lamina and the expansion of adult precursor satellite cells (muscle stem cells). Accompanying this second phase is innervation of the myofibers leading to the formation of the neuromuscular junctions. Finally, postnatal myogenesis is achieved via myoblasts derived from satellite cells that are responsible for growth and regeneration of mature skeletal muscle. Myogenesis and muscle development involve the interaction of cell surfaces and ECM with hundreds of glycosylated proteins. It is therefore not surprising that defects in glycosylation have been associated with several developmental disorders. More than 50 congenital disorders of glycosylation (CDGs) have been identified in humans, and these typically present as abnormalities in development of the nervous system and/or skeletal muscle during infancy (6Scott K. Gadomski T. Kozicz T. Morava E. Congenital disorders of glycosylation: new defects and still counting.J. Inherit. Metab. Dis. 2014; 37: 609-617Crossref PubMed Scopus (89) Google Scholar). The majority of CDGs are inherited defects in one or more of the multiple enzymes responsible for glycosylation of asparagine residues (N-linked glycosylation) that occur on membrane-associated, cell surface, and secreted proteins. For example, several loss-of-function mutations have been identified in the PMM2 gene involved in the synthesis of GDP-mannose, a nucleotide-sugar donor responsible for the transfer of mannose residues to N-glycans and thus critical for their maturation. Individuals with PMM2-CDG have hypo-N-glycosylation and display severe hypotonic muscles and underdeveloped cerebellum (7Grunewald S. The clinical spectrum of phosphomannomutase 2 deficiency (CDG-Ia).Biochim. Biophys. Acta. 2009; 1792: 827-834Crossref PubMed Scopus (93) Google Scholar). Advances in next-generation DNA sequencing have pin-pointed additional CDGs in patients presenting with abnormal N-glycosylation and defects in muscle and/or nervous system development. This includes the identification of mutations in the STT3A and STT3B genes forming the catalytic subunits of the N-oligosaccharyl transferase complex (8Shrimal S. Ng B.G. Losfeld M.E. Gilmore R. Freeze H.H. Mutations in STT3A and STT3B cause two congenital disorders of glycosylation.Hum. Mol. Genet. 2013; 22: 4638-4645Crossref PubMed Scopus (47) Google Scholar), and MAN1B1, which are involved in the regulation of N-linked glycosylation (9Rymen D. Peanne R. Millon M.B. Race V. Sturiale L. Garozzo D. Mills P. Clayton P. Asteggiano C.G. Quelhas D. Cansu A. Martins E. Nassogne M.C. Goncalves-Rocha M. Topaloglu H. et al.MAN1B1 deficiency: an unexpected CDG-II.PLoS Genet. 2013; 9e1003989Crossref PubMed Scopus (46) Google Scholar). Despite the well-documented mutations in genes regulating glycosylation and their associations with poor muscle function, we know very little about the regulation of N-glycosylation during myogenesis and muscle development. Furthermore, the roles of glycan-binding proteins such as lectins on myogenesis and muscle development remain only partially understood. For example, loss of Lgals1 expression results in defects in muscle development in mice and fish (10Georgiadis V. Stewart H.J. Pollard H.J. Tavsanoglu Y. Prasad R. Horwood J. Deltour L. Goldring K. Poirier F. Lawrence-Watt D.J. Lack of galectin-1 results in defects in myoblast fusion and muscle regeneration.Dev. Dyn. 2007; 236: 1014-1024Crossref PubMed Scopus (60) Google Scholar, 11Ahmed H. Du S.J. Vasta G.R. Knockdown of a galectin-1-like protein in zebrafish (Danio rerio) causes defects in skeletal muscle development.Glycoconj. J. 2009; 26: 277-283Crossref PubMed Scopus (23) Google Scholar). The molecular mechanisms remain poorly defined, but in vitro experiments suggest galectin-1 binds to a variety of ECM proteins including laminins and integrins at the sarcolemma to regulate intracellular signaling (12Gu M. Wang W. Song W.K. Cooper D.N. Kaufman S.J. Selective modulation of the interaction of alpha 7 beta 1 integrin with fibronectin and laminin by L-14 lectin during skeletal muscle differentiation.J. Cell Sci. 1994; 107: 175-181Crossref PubMed Google Scholar). Muscular dystrophies are characterized by progressive muscle degeneration, sarcolemmal damage, and loss of muscle function. Analysis of immortalized healthy and dystrophic human muscle cells with lectin histochemistry has recently revealed several changes in lectin binding, suggesting discrete changes in glycosylation or glycoprotein abundance (13McMorran B.J. Miceli M.C. Baum L.G. Lectin-binding characterizes the healthy human skeletal muscle glycophenotype and identifies disease-specific changes in dystrophic muscle.Glycobiology. 2017; 27: 1134-1143Crossref PubMed Scopus (4) Google Scholar). Excitingly, administration of recombinant galectin-1 in a genetic mouse model of muscular dystrophy (newborn mdx mice) displays improved muscle function and sarcolemmal integrity, suggesting critical roles of galectin-1 in myogenesis (14Wuebbles R.D. Cruz V. Van Ry P. Barraza-Flores P. Brewer P.D. Jones P. Burkin D.J. Human galectin-1 improves sarcolemma stability and muscle vascularization in the mdx mouse model of duchenne muscular dystrophy.Mol. Ther. Methods Clin. Dev. 2019; 13: 145-153Abstract Full Text Full Text PDF PubMed Scopus (3) Google Scholar). These experiments are encouraging as they highlight new potential treatment options for a variety of muscle diseases. However, further experiments are required to characterize the role of N-glycosylation and galectin-1 on myogenesis and muscle development. Rat L6 myoblasts were maintained in an α-minimum essential medium containing 5.5-mM glucose (Gibco) and 10% fetal bovine serum (FBS; Hyclone Laboratories) in a 10% CO2 incubator. L6 myoblasts were differentiated into myotubes over 7 days with 2% FBS when myoblasts reached ∼90 to 95% confluency. For CRISPR/Cas9 experiments targeting complete disruption of Lgals1, myoblasts were transfected at 60% confluency with DNA constructs expressing CMV-Cas9(D10A) and paired U6-gRNAs (5’-GTTGTTGCTGTCTTTCCCCAGG and 5’- ACCCCCGCTTCAACGCCCATGG) (Sigma Aldrich) using TransIT-X2 reagent (Mirus Bio). After 48 h, cells were trypsinized, counted, and serial-diluted to ∼0.8 cells per 30 μl in fresh conditioned α-minimum essential medium media containing 10% FBS. Cells were seeded into 384-well plates with media replaced every 2 to 3 days and single clones selected. After 10 days, cells were expanded and screened for LGALS1 ablation using Western blot analysis. Cells were washed twice with ice-cold PBS and lysis in ice-cold 100-mM sodium carbonate containing protease inhibitor cocktail (Roche) by tip-probe sonication. Lysates were rotated at 4 °C for 1 h and then centrifuged at 150,000g for 60 min at 4 °C to pellet microsomal protein fraction. The pellet was resuspended in 6 M urea, 2 M thiourea, 1% SDS containing 25 mM triethylammonium bicarbonate (TEAB), pH 8.0, and protein precipitated with chloroform:methanol:water (1:3:4). Precipitated protein was washed with methanol and resuspended in 6 M urea and 2 M thiourea containing 25-mM TEAB, pH 8.0. The protein concentration was determined via Qubit (Invitrogen), normalized and stored at −80 °C. Peptides were prepared essentially as described previously (15Parker B.L. Thaysen-Andersen M. Fazakerley D.J. Holliday M. Packer N.H. James D.E. Terminal galactosylation and sialylation switching on membrane glycoproteins upon TNF-alpha-induced insulin resistance in adipocytes.Mol. Cell. Proteomics. 2016; 15: 141-153Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). Briefly, 35 μg of membrane-enriched protein from each of the eight time points (0–7 days) and each biological replicate (n = 3) were reduced with 10-mM DTT for 1 h at RT followed by alkylation with 25-mM iodoacetamide for 30 min at RT in the dark. The reaction was quenched to 25-mM DTT and digested with 0.7-μg of sequencing-grade LysC (Wako Chemicals) for 3 h at RT. The digest was diluted 5-fold with 25-mM TEAB and digested with 0.7 μg of sequencing-grade trypsin (Sigma) overnight at 30 °C. Samples were acidified to a final concentration of 2% formic acid, centrifuged at 13,000g for 10 min at RT and desalted using 30 mg of hydrophilic–lipophilic balance–solid phase extraction material in a 96-well plate (Waters) using a vacuum manifold. The plate was washed with 5% acetonitrile (MeCN) containing 0.1% TFA. The peptides were eluted with 50% MeCN containing 0.1% TFA and dried by vacuum centrifugation. Peptides were resuspended in 20 μl of 100-mM Hepes, pH 8.0, and isotopically labeled with 73 μg of 10-plex tandem mass tags (TMTs) in a final concentration of 33% MeCN for 2 h at RT. The sample channels were labeled as follows: 126 = day 0, 127N = day 1, 127C = day 2, 128N = day 3, 128C = day 4, 129N = day 5, 129C = day 6, 130N = day 7. The reactions were quenched with 0.8% hydroxylamine for 15 min at RT, and then acidified and diluted to a final concentration of 0.1% TFA and 5% MeCN. The labeled peptides were pooled and purified by hydrophilic–lipophilic balance–solid phase extraction as described above. Peptides were resuspended in 90% MeCN containing 0.1% TFA and 10% of the peptide separated directly into 12 fractions for total proteome analysis using amide-80 hydrophilic interaction liquid chromatography as described previously (16Palmisano G. Lendal S.E. Engholm-Keller K. Leth-Larsen R. Parker B.L. Larsen M.R. Selective enrichment of sialic acid-containing glycopeptides using titanium dioxide chromatography with analysis by HILIC and mass spectrometry.Nat. Protoc. 2010; 5: 1974-1982Crossref PubMed Scopus (185) Google Scholar). Glycopeptides were enriched from 90% of the remaining peptide using zwitterionic-hydrophilic interaction liquid chromatography microcolumns as previously described (17Hagglund P. Bunkenborg J. Elortza F. Jensen O.N. Roepstorff P. A new strategy for identification of N-glycosylated proteins and unambiguous assignment of their glycosylation sites using HILIC enrichment and partial deglycosylation.J. Proteome Res. 2004; 3: 556-566Crossref PubMed Scopus (393) Google Scholar, 18Mysling S. Palmisano G. Hojrup P. Thaysen-Andersen M. Utilizing ion-pairing hydrophilic interaction chromatography solid phase extraction for efficient glycopeptide enrichment in glycoproteomics.Anal. Chem. 2010; 82: 5598-5609Crossref PubMed Scopus (209) Google Scholar). The analysis of each fraction for proteome quantification was performed on a Dionex 3500RS coupled to an Orbitrap Fusion (Thermo Scientific) operating in a positive polarity mode. Peptides were separated using an in-house packed 75-μm × 50-cm pulled column (1.9-μm particle size, C18AQ; Dr Maisch, Germany) with a gradient of 2 to 40% MeCN containing 0.1% formic acid over 150 min at 250 nl/min at 55 °C. MS1 scans were acquired from 350 to 1400 m/z (120,000 resolution, 5e5 AGC, 50 ms injection time) followed by tandem mass spectrometry (MS/MS) data-dependent acquisition of the 10 most intense ions with collision-induced dissociation (CID) and detection in the ion-trap (rapid scan rate, 1e4 AGC, 70-ms injection time, 30% NCE, 1.6 m/z isolation width). Synchronous precursor selection was enabled with multinotch isolation of the 10 most abundant fragment ions excluding precursor window of 40 m/z and loss of TMT reporter ions for MS3 analysis by higher collisional dissociation (HCD) and detection in the Orbitrap (60,000 resolution, 1e5 AGC, 300-ms injection time, 100–500 m/z, 55% NCE, 2 m/z) (19McAlister G.C. Nusinow D.P. Jedrychowski M.P. Wuhr M. Huttlin E.L. Erickson B.K. Rad R. Haas W. Gygi S.P. MultiNotch MS3 enables accurate, sensitive, and multiplexed detection of differential expression across cancer cell line proteomes.Anal. Chem. 2014; 86: 7150-7158Crossref PubMed Scopus (566) Google Scholar). The analysis of glycopeptides was performed as single-shot analysis without fractionation on the identical system as described above. MS1 scans were acquired from 550 to 1750 m/z (120,000 resolution, 5e5 AGC, 100-ms injection time) followed by MS/MS data–dependent acquisition of the 7 most intense ions and highest charge state with HCD and detection in the Orbitrap (60,000 resolution, 2e5 AGC, 200-ms injection time, 40 NCE, 2 m/z quadrupole isolation width). The acquisition strategy included a product ion triggered reisolation of the precursor ion if HexNAc oxonium ions (138.0545 and 204.0867 m/z) were detected amongst the top 20 fragment ions of the HCD-MS/MS spectrum. The reisolated precursor ions were subjected to both electron transfer dissociation with higher collisional dissociation supplemental activation (EThcD)-MS/MS and CID-MS/MS analysis (20Frese C.K. Altelaar A.F. van den Toorn H. Nolting D. Griep-Raming J. Heck A.J. Mohammed S. Toward full peptide sequence coverage by dual fragmentation combining electron-transfer and higher-energy collision dissociation tandem mass spectrometry.Anal. Chem. 2012; 84: 9668-9673Crossref PubMed Scopus (183) Google Scholar, 21Saba J. Dutta S. Hemenway E. Viner R. Increasing the productivity of glycopeptides analysis by using higher-energy collision dissociation-accurate mass-product-dependent electron transfer dissociation.Int. J. Proteomics. 2012; 2012: 560391Crossref PubMed Google Scholar, 22Wu S.W. Pu T.H. Viner R. Khoo K.H. Novel LC-MS(2) product dependent parallel data acquisition function and data analysis workflow for sequencing and identification of intact glycopeptides.Anal. Chem. 2014; 86: 5478-5486Crossref PubMed Scopus (63) Google Scholar). EThcD-MS/MS analysis was detected in the Orbitrap (60,000 resolution, 3e5 AGC, 250 ms injection time, calibrated charge dependent ETD reaction times [2+ 121 ms; 3+ 54 ms; 4+ 30 ms; 5+ 20 ms; 6+ 13 ms; 7+; 10 ms], 2 m/z quadrupole isolation width), and CID-MS/MS analysis was detected in the ion trap (rapid scan rate, 1e4 AGC, 70-ms injection time, 35% NCE, 2 m/z quadrupole isolation width). Data are available via ProteomeXchange with identifier PXD019372 (23Perez-Riverol Y. Csordas A. Bai J. Bernal-Llinares M. Hewapathirana S. Kundu D.J. Inuganti A. Griss J. Mayer G. Eisenacher M. Perez E. Uszkoreit J. Pfeuffer J. Sachsenberg T. Yilmaz S. et al.The PRIDE database and related tools and resources in 2019: improving support for quantification data.Nucleic Acids Res. 2019; 47: D442-D450Crossref PubMed Scopus (2563) Google Scholar). Username: [email protected] and Password: KGAgOAkh The identification and quantification of peptides for proteomic analysis was performed with Proteome Discoverer (v2.1.0.801) using Sequest (24MacCoss M.J. Wu C.C. Yates 3rd, J.R. Probability-based validation of protein identifications using a modified SEQUEST algorithm.Anal. Chem. 2002; 74: 5593-5599Crossref PubMed Scopus (326) Google Scholar) against the rat UniProtKB database (November 2015; 31,095 entries). The precursor mass tolerance was set to 20 ppm with a maximum of two full trypsin miss cleavages while the CID-MS/MS fragment mass tolerance was set to 0.6 Da. The peptides were searched with oxidation of methionine set as variable modifications, whereas carbamidomethylation of cysteine and TMT of peptide N-terminus and lysine was set as a fixed modification. All data were searched as a single batch with peptide spectral match (PSM) and peptide false discovery rate (FDR) filtered to 1% using Percolator (25Kall L. Canterbury J.D. Weston J. Noble W.S. MacCoss M.J. Semi-supervised learning for peptide identification from shotgun proteomics datasets.Nat. Methods. 2007; 4: 923-925Crossref PubMed Scopus (1141) Google Scholar) and protein level FDR set to 1% using the Protein FDR Validator node. Quantification was performed using the Reporter Ion Quantifier node with integration set to 20 ppm and coisolation threshold set to 50%, and reporter ions were required in all channels. Peptides were grouped in each replicate based on unique sequence and unique modifications, and the median reporter ion areas calculated. Data were expressed as Log2 fold change to day 0 for each replicate and normalized to a median of 0. Total proteome from biological replicates across time points were batch effect corrected using an empirical Bayes model implemented in the sva R package (26Johnson W.E. Li C. Rabinovic A. Adjusting batch effects in microarray expression data using empirical Bayes methods.Biostatistics. 2007; 8: 118-127Crossref PubMed Scopus (3144) Google Scholar). As recommended, the parametric shrinkage adjustment was applied to the data. The quality of the data after batch effect correction was assessed using the principal component analysis, and the corrected data were used for subsequent analysis. Significantly regulated glycopeptides were determined using ANOVA with permutation-based FDR set at 5% with Tukey’s post hoc test. The identification and quantification of glycopeptides was performed with Proteome Discoverer (v2.1.0.801) using the Byonic node (v2.3.5) (27Bern M. Kil Y.J. Becker C. Byonic: advanced peptide and protein identification software.Curr. Protoc. Bioinformatics. 2012; (Chapter 13, Unit13 20)Crossref PubMed Scopus (268) Google Scholar) against the rat UniProtKB database (November 2015; 31,095 entries). The precursor, HCD-MS/MS, and EThcD-MS/MS mass tolerance were set to 20 ppm with a maximum of two full trypsin miss cleavages. The peptides were searched with oxidation of methionine and N-glycan modification of asparagine (309 possible glycan compositions without sodium adducts available within Byonic) set as variable modifications, whereas carbamidomethylation of cysteine and TMT of peptide N-terminus and lysine were considered as fixed modifications. A precursor isotope off set was enabled (narrow) to account for incorrect precursor monoisotopic identification (±1.0 Da). All data were searched as a single batch with PSM FDR set to 1% using the PSM validator node, and a minimum Byonic score of 100 was applied, which has previously been shown to provide a good balance between accuracy and coverage (28Lee L.Y. Moh E.S. Parker B.L. Bern M. Packer N.H. Thaysen-Andersen M. Toward automated N-glycopeptide identification in glycoproteomics.J. Proteome Res. 2016; 15: 3904-3915Crossref PubMed Scopus (67) Google Scholar). Only HCD-MS/MS spectra containing HexNAc oxonium ions (138.05–138.06 and 204.08–204.09 m/z) were annotated in the final list of glycopeptides as previously described (29Parker B.L. Thaysen-Andersen M. Solis N. Scott N.E. Larsen M.R. Graham M.E. Packer N.H. Cordwell S.J. Site-specific glycan-peptide analysis for determination of N-glycoproteome heterogeneity.J. Proteome Res. 2013; 12: 5791-5800Crossref PubMed Scopus (126) Google Scholar). All identified glycopeptides were quantified based on HCD-MS/MS data using the Reporter Ions Quantifier node with integration set to 20 ppm and coisolation threshold set to 75%. Reporter ions were required in all channels. Peptides were grouped in each replicate based on unique sequence and unique modifications, and the median reporter ion areas were calculated. Data were expressed as Log2 fold change to day 0 for each replicate and normalized to a median of 0. Significantly regulated glycopeptides were determined using ANOVA with permutation-based FDR set at 5% with Tukey’s post hoc test. N-glycome profiling was performed essentially as described previously (30Jensen P.H. Karlsson N.G. Kolarich D. Packer N.H. Structural analysis of N- and O-glycans released from glycoproteins.Nat. Protoc. 2012; 7: 1299-1310Crossref PubMed Scopus (237) Google Scholar). Briefly, 10-μg protein extracts were dot-blotted onto polyvinylidene fluoride membranes and allowed to dry overnight. The membranes were stained briefly with direct blue 71 in 40% ethanol containing 10% acetic acid and washed with water. Immobilized proteins were excised and the membrane blocked with 1% polyvinyl pyrrolidine 4000 for 5 min followed by washing with water. N-glycans were released with 2.5 U PNGase F (Roche, Australia) for 16 h at 37 °C. Released glycans were collected, incubated with 100-mM ammonium acetate, pH 5.0, for 1 h at 23 °C and dried by vacuum centrifugation. N-glycans were reduced with 1 M NaBH4 in 50 mM KOH for 3 h at 50 °C and then desalted and enriched offline using AG 50W-X8 (Bio-Rad, Australia) strong cation exchange followed by porous graphitized carbon (PGC) solid-phase extraction microcolumns (Grace). For the determination of galactose linkages, aliquots of released glycans were incubated with combinations of 20 U broad-specificity sialidase (P0722S, α2-3,6,8,9), 8 U broad-specificity α-galactosidase (P0747S, α1-3,4,6), 10 U β-galactosidase (P0726S, β1-3), and 8 U β-galactosidase (P0746S, β1-3,4) (all from New England BioLabs). All reactions were performed in a final volume of 10 μl in 50-mM sodium acetate buffer, 5 mM CaCl2, pH 5.5, for 16 h at 37 °C. PGC-LC-ESI-MS/MS experiments were performed on a 3D ion trap using an Agilent 1100 capillary LC system (Agilent Technologies) interfaced with an Agilent 6330 LC-MSD 3D Trap XCT ultra. A PGC LC column (3 μm, 100 mm × 0.18 mm, Hypercarb, Thermo Scientific) was maintained at RT and at 50 °C. 10-mM ammonium bicarbonate aqueous solution (solvent A) and 10-mM ammonium bicarbonate aqueous solution with 45% MeCN (solvent B) were used as mobile phases at 2 μl/min with the following gradient: 0 min, 2% B; linear increase up to 35% B for 53 min; linear increase up to 100% B for 20 min; held constant for 5 min; and then equilibrated at 2% B for 5 min before the next injection—giving a total LC run time of 83 min. Glycans were analyzed using the following ESI-MS conditions: source voltage −3.2 kV, MS1 scan range 350 to 2200 m/z, 5 microscans, 0.13 m/z resolution (FWHM), 8e4 ion current control (ICC), and 200-ms accumulation time. Ion trap CID-MS/MS conditions were as follows: 0.13 m/z resolution (FWHM), 8e4 ICC, 200 ms accumulation time, 4 m/z isolation width and data-dependent acquisition of the three most abundant glycan precursors in each scan. The CID-MS/MS used ultrapure helium as the collision cell gas. Fragmentation amplitude was set to 1 V with Smart-Frag–enabled ramping from 30 to 200% of the fragmentation amplitude for CID-MS/MS with an activation time of 40 ms. Data were analyzed as described previously (31Adams K.J. Pratt B. Bose N. Dubois L.G. St John-Williams L. Perrott K.M. Ky K. Kapahi P. Sharma V. MacCoss M.J. Moseley M.A. Colton C.A. MacLean B.X. Schilling B. Thompson J.W. et al.Skyline for small molecules: a unifying software package for quantitative metabolomics.J. Proteome Res. 2020; 19: 1447-1458Crossref PubMed Scopus (30) Google Scholar). Briefly, a candidate list