Inhibitor of apoptosis (IAP) proteins inhibit caspases, a function counteracted by IAP antagonists, insect Grim, HID, and Reaper and mammalian DIABLO/Smac. We now demonstrate that HtrA2, a mammalian homologue of the Escherichia coli heat shock-inducible protein HtrA, can bind to MIHA/XIAP, MIHB, and baculoviral OpIAP but not survivin. Although produced as a 50-kDa protein, HtrA2 is processed to yield an active serine protease with an N terminus similar to that of Grim, Reaper, HID, and DIABLO/Smac that mediates its interaction with XIAP. HtrA2 is largely membrane-associated in healthy cells, with a significant proportion observed within the mitochondria, but in response to UV irradiation, HtrA2 shifts into the cytosol, where it can interact with IAPs. HtrA2 can, like DIABLO/Smac, prevent XIAP inhibition of active caspase 3in vitro and is able to counteract XIAP protection of mammalian NT2 cells against UV-induced cell death. The proapoptotic activity of HtrA2 in vivo involves both IAP binding and serine protease activity. Mutations of either the N-terminal alanine of mature HtrA2 essential for IAP interaction or the catalytic serine residue reduces the ability of HtrA2 to promote cell death, whereas a complete loss in proapoptotic activity is observed when both sites are mutated. Inhibitor of apoptosis (IAP) proteins inhibit caspases, a function counteracted by IAP antagonists, insect Grim, HID, and Reaper and mammalian DIABLO/Smac. We now demonstrate that HtrA2, a mammalian homologue of the Escherichia coli heat shock-inducible protein HtrA, can bind to MIHA/XIAP, MIHB, and baculoviral OpIAP but not survivin. Although produced as a 50-kDa protein, HtrA2 is processed to yield an active serine protease with an N terminus similar to that of Grim, Reaper, HID, and DIABLO/Smac that mediates its interaction with XIAP. HtrA2 is largely membrane-associated in healthy cells, with a significant proportion observed within the mitochondria, but in response to UV irradiation, HtrA2 shifts into the cytosol, where it can interact with IAPs. HtrA2 can, like DIABLO/Smac, prevent XIAP inhibition of active caspase 3in vitro and is able to counteract XIAP protection of mammalian NT2 cells against UV-induced cell death. The proapoptotic activity of HtrA2 in vivo involves both IAP binding and serine protease activity. Mutations of either the N-terminal alanine of mature HtrA2 essential for IAP interaction or the catalytic serine residue reduces the ability of HtrA2 to promote cell death, whereas a complete loss in proapoptotic activity is observed when both sites are mutated. inhibitor of apoptosis protein mammalian IAP homologue A baculoviral IAP repeat monoclonal antibody immobilized pH gradient mass spectrometry hemagglutinin high pressure liquid chromatography 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid bovine serum albumin green fluorescent protein fluorescein isothiocyanate wild type Inhibitor of apoptosis (IAP)1 proteins were first identified as baculoviral gene products that inhibited the defensive apoptotic response of insect cells following infection (1Crook N.E. Clem R.J. Miller L.K. J. Virol. 1993; 67: 2168-2174Crossref PubMed Google Scholar). Subsequently, IAP homologues have been identified in both invertebrates and vertebrates (2Rothe M. Pan M.G. Henzel W.J. Ayres T.M. Goeddel D.V. Cell. 1995; 83: 1243-1252Abstract Full Text PDF PubMed Scopus (1062) Google Scholar, 3Uren A.G. Pakusch M. Hawkins C.J. Puls K.L. Vaux D.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4974-4978Crossref PubMed Scopus (449) Google Scholar, 4Liston P. Roy N. Tamai K. Lefebvre C. Baird S. Chertonhorvat G. Farahani R. Mclean M. Ikeda J.E. Mackenzie A. Korneluk R.G. Nature. 1996; 379: 349-353Crossref PubMed Scopus (876) Google Scholar, 5Duckett C.S. Nava V.E. Gedrich R.W. Clem R.J. Vandongen J.L. Gilfillan M.C. Shiels H. Hardwick J.M. Thompson C.B. EMBO J. 1996; 15: 2685-2694Crossref PubMed Scopus (526) Google Scholar). IAPs inhibit cell death by binding to caspases, the effector proteases of apoptosis. For example, mammalian IAP homologue A (MIHA; also termed XIAP) can bind to and inhibit processed caspase 9 and processed caspase 3 (6Deveraux Q.L. Takahashi R. Salvesen G.S. Reed J.C. Nature. 1997; 388: 300-304Crossref PubMed Scopus (1733) Google Scholar, 7Srinivasula S.M. Hegde R. Saleh A. Datta P. Shiozaki E. Chai J.J. Lee R.A. Robbins P.D. Fernandes-Alnemri T. Shi Y.G. Alnemri E.S. Nature. 2001; 410: 112-116Crossref PubMed Scopus (875) Google Scholar, 8Ekert P.G. Silke J. Hawkins C.J. Verhagen A.M. Vaux D.L. J. Cell Biol. 2001; 152: 483-490Crossref PubMed Scopus (163) Google Scholar), and DrosophilaDIAP1 can bind to and inhibit the initiator caspases DRONC and the downstream caspases drICE and DCP-1 (9Wang S.L. Hawkins C.J. Yoo S.J. Muller H.A.J. Hay B.A. Cell. 1999; 98: 453-463Abstract Full Text Full Text PDF PubMed Scopus (439) Google Scholar, 10Meier P. Silke J. Leevers S.J. Evan G.I. EMBO J. 2000; 19: 598-611Crossref PubMed Scopus (279) Google Scholar, 11Hawkins C.J. Yoo S.J. Peterson E.P. Wang S.L. Vernooy S.Y. Hay B.A. J. Biol. Chem. 2000; 275: 27084-27093Abstract Full Text Full Text PDF PubMed Google Scholar). IAPs from Drosophila and mammals can be antagonized by proapoptotic proteins that bind directly to them via their N termini. For example, Grim, HID, and Reaper can promote cell death by binding to DIAP1, and DIABLO/Smac can promote cell death by binding to MIHA/XIAP (12Verhagen A.M. Ekert P.G. Pakusch M. Silke J. Connolly L.M. Reid G.E. Moritz R.L. Simpson R.J. Vaux D.L. Cell. 2000; 102: 43-53Abstract Full Text Full Text PDF PubMed Scopus (2001) Google Scholar, 13Du C.Y. Fang M. Li Y.C. Li L. Wang X.D. Cell. 2000; 102: 33-42Abstract Full Text Full Text PDF PubMed Scopus (2977) Google Scholar). The mature N termini of all four proapoptotic proteins are similar, beginning with an alanine residue that is essential for interaction with the IAP (14Vucic D. Kaiser W.J. Harvey A.J. Miller L.K. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 10183-10188Crossref PubMed Scopus (189) Google Scholar, 15Vucic D. Kaiser W.J. Miller L.K. Mol. Cell. Biol. 1998; 18: 3300-3309Crossref PubMed Scopus (188) Google Scholar, 16Chai J.J. Du C.Y. Wu J.W. Kyin S. Wang X.D. Shi Y.G. Nature. 2000; 406: 855-862Crossref PubMed Scopus (730) Google Scholar, 17Liu Z.H. Sun C.H. Olejniczak E.T. Meadows R.P. Betz S.F. Oost T. Herrmann J. Wu J.C. Fesik S.W. Nature. 2000; 408: 1004-1008Crossref PubMed Scopus (553) Google Scholar, 18Wu G. Chai J.J. Suber T.L. Wu J.W. Du C.Y. Wang X.D. Shi Y.G. Nature. 2000; 408: 1008-1012Crossref PubMed Scopus (721) Google Scholar). By binding to IAPs, these proteins displace active caspases or prevent IAPs from binding active caspases and thus promote death of the cell. For example, when DIABLO binds to XIAP, it prevents XIAP from binding processed caspase 9 and thus promotes cell death following UV irradiation (7Srinivasula S.M. Hegde R. Saleh A. Datta P. Shiozaki E. Chai J.J. Lee R.A. Robbins P.D. Fernandes-Alnemri T. Shi Y.G. Alnemri E.S. Nature. 2001; 410: 112-116Crossref PubMed Scopus (875) Google Scholar, 8Ekert P.G. Silke J. Hawkins C.J. Verhagen A.M. Vaux D.L. J. Cell Biol. 2001; 152: 483-490Crossref PubMed Scopus (163) Google Scholar). To find additional proapoptotic proteins that bind to mammalian IAPs, we transiently transfected 293T cells with epitope-tagged XIAP and co-immunoprecipitated associated proteins. These proteins were separated by two-dimensional polyacrylamide electrophoresis and sequenced by nanoelectrospray tandem mass spectrometry. Here we describe identification of HtrA2, also known as Omi (19Faccio L. Fusco C. Chen A. Martinotti S. Bonventre J.V. Zervos A.S. J. Biol. Chem. 2000; 275: 2581-2588Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, 20Gray C.W. Ward R.V. Karran E. Turconi S. Rowles A. Viglienghi D. Southan C. Barton A. Fantom K.G. West A. Savopoulos J. Hassan N.J. Clinkenbeard H. Hanning C. Amegadzie B. Davis J.B. Dingwall C. Livi G.P. Creasy C.L. Eur. J. Biochem. 2000; 267: 5699-5710Crossref PubMed Scopus (237) Google Scholar), as a MIHA/XIAP-binding protein. HtrA2 is a mammalian homologue of the bacterial heat-inducible serine protease known as HtrA or DegP (21Pallen M.J. Wren B.W. Mol. Microbiol. 1997; 26: 209-221Crossref PubMed Scopus (332) Google Scholar). In bacteria, HtrA primarily acts as a molecular chaperone at low temperatures and as a protease that degrades misfolded proteins at high temperatures (22Spiess C. Beil A. Ehrmann M. Cell. 1999; 97: 339-347Abstract Full Text Full Text PDF PubMed Scopus (642) Google Scholar). Escherichia coli HtrA bears two PDZ domains at its C terminus that are involved in substrate recognition. Bacteria lacking HtrA have reduced viability when cultured at 42 °C (23Skorkoglonek J. Wawrzynow A. Krzewski K. Kurpierz K. Lipinska B. Gene (Amst.). 1995; 163: 47-52Crossref PubMed Scopus (86) Google Scholar). Because of its activities as a chaperone or as a protease, it is thought that HtrA may determine whether misfolded proteins are refolded or alternatively targeted for destruction. Mammalian HtrA2 interacts with XIAP through its processed N terminus, is able to antagonize IAP inhibition of active caspase 3 in vitro, and can overcome XIAP protection of mammalian NT2 cells against UV-induced cell death through both its serine protease activity and IAP binding activity. Expression constructs (pEF BOS) encoding C- and N-terminally FLAG epitope-tagged XIAP (FLAG-XIAP) and N-terminally FLAG-tagged CrmADQMD variant (FLAG-DQMD) have been previously described (3Uren A.G. Pakusch M. Hawkins C.J. Puls K.L. Vaux D.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4974-4978Crossref PubMed Scopus (449) Google Scholar, 12Verhagen A.M. Ekert P.G. Pakusch M. Silke J. Connolly L.M. Reid G.E. Moritz R.L. Simpson R.J. Vaux D.L. Cell. 2000; 102: 43-53Abstract Full Text Full Text PDF PubMed Scopus (2001) Google Scholar, 24Ekert P.G. Silke J. Vaux D.L. EMBO J. 1999; 18: 330-338Crossref PubMed Scopus (74) Google Scholar). pEF BOS constructs encoding C-terminally FLAG-tagged survivin and C-terminally FLAG-tagged MIHBΔring (amino acids 1–573) were generated by PCR amplification of cDNA regions and subcloning into the vector. A muHtrA2 cDNA fragment with a Kozak initiation site was amplified by PCR from IMAGE consortium clone AA171302 and subcloned into pcDNA3.HA1 vector (kindly provided by Dr. David Huang). The muHtrA2HA fragment from this construct was then subcloned into pEF BOS. Overlap PCR technology was used to generate pEF HtrA2-A144G-HA and pEF HtrA2-A147I-HA mutant constructs. pEF vector encoding C-terminally HA epitope-tagged DIABLO/HtrA2 chimeric constructs and mutants were generated using overlap PCR technology. The DIABLO/HtrA2 chimera comprises the mitochondrial import sequence of DIABLO (amino acids 1–53) fused to the N-terminal Alanine of mature HtrA2 (amino acid 144). The C terminus of HtrA2 is HA epitope-tagged. Where indicated, the N-terminal alanine of HtrA2 has been mutated to glycine (A144G), and/or the catalytic serine residue has been changed to alanine (S306A). A Kozak initiation sequence directs the translation of all constructs. The pEFDIABLOA54G construct was similarly generated using overlap PCR technology. pEF constructs encoding FLAG-tagged XIAP mutants were generated using overlap PCR technology. The D148A construct has already been described (25Silke J. Ekert P.G. Day C.L. Hawkins C.J. Baca M. Chew J. Pakusch M. Verhagen A.M. Vaux D.L. EMBO J. 2001; 20: 3114-3123Crossref PubMed Scopus (100) Google Scholar). The other mutants were generated with combinations of the primers 759 BstBI (5′-tgcttctttgttttgggccgga-3′), 760 E314S (5′-aactgattggaagcccagttccgacccttgggaacaacatgct-3′), 766 W310A (5′-tggaggagggctaactgatgcgaagcccagtgaagacc-3′), 770 EcoRV (5′-ctgtctttctgagcattcactagat-3′), 771 D214S (5′-tgggaaccttgctcgagagcctggtcagaacacag-3′), 772 N259D (5′-tcaacaaatcttcctcgagatccatccatggcagatta-3′). FLAG-tagged XIAP domain constructs were generated using PfuI polymerase PCR and the primers 743 baculoviral IAP repeat 2 (BIR2) (5′-cgggatccaccatgcgtgatcattttgccttagacag-3′), 744 BIR2 (5′-cgcgctagctggattcctaggaagatttgttgaatttggg-3′), 771 BIR1 (5′-cgggatccaccatgacttttaacagttttgaaggatcta-3′), 745 BIR1 (5′-ccgccctaggggcaaaaagatctctgcttcccagatagtt-3′), 747 BIR3 (5′-ccgccctaggaatccatccatggcagattat-3′), 750 XIAP (5′-cgtctagacataaaaattttttgcttgaa-3′), 761 BIR3 (5′-cggaattcggatccaccatgtctgatgctgtgagttc-3′), and 762 BIR3 (5′ gcgttagctagcggagatctgagtagttcttaccagacact 3′) and cloned into the vector pEF c-term FLAG using sites compatible with BamHI andNheI. The HtrA2 bacterial expression constructs were cloned with PCR using 925 (5′-gctctagattctgtgacctcgggggtcacata-3′), 927 (5′-cagctccgtgagccaagtttccctgatgttcagca-3′), and 924 (5′-cgccagatctaccatggctgttcctgctccgccaccca-3′) and put into a pET 15b derivative. All constructs were verified by digest and sequencing. The human embryonic kidney carcinoma cell line 293T was grown in RPMI medium supplemented with 10% fetal calf serum, 1% penicillin/streptomycin, and 2% glutamine and was transiently transfected with different mammalian expression constructs using polyethyleneimine as described (26Boussif O. Lezoualch F. Zanta M.A. Mergny M.D. Scherman D. Demeneix B. Behr J.P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7297-7301Crossref PubMed Scopus (5714) Google Scholar) or EffecteneTM (Qiagen, Germany) according to manufacturer's instructions. Transfection efficiency was visualized by co-transfection with pEGFP (CLONTECH). Where indicated, cells were metabolically labeled with [35S]methionine in RPMI plus 10% fetal calf serum 24 h prior to harvest. Mammalian NT2 cells were transfected as previously described (8Ekert P.G. Silke J. Hawkins C.J. Verhagen A.M. Vaux D.L. J. Cell Biol. 2001; 152: 483-490Crossref PubMed Scopus (163) Google Scholar, 12Verhagen A.M. Ekert P.G. Pakusch M. Silke J. Connolly L.M. Reid G.E. Moritz R.L. Simpson R.J. Vaux D.L. Cell. 2000; 102: 43-53Abstract Full Text Full Text PDF PubMed Scopus (2001) Google Scholar). In brief, six-well plates were seeded 24 h prior to transfection with 1 × 105 NT2 cells/well. They were transiently transfected with 0.25 μg pEF expression constructs plus 0.025 μg of pEGFP/well using Effectene (Qiagen). Cells were lysed in a Triton X-100-based lysis buffer (1% Triton X-100, 10% glycerol, 150 mm NaCl, 20 mm Tris, pH 7.5, 2 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, and 10 μg/ml leupeptin) for 1 h, and the nuclear and cellular debris was cleared by centrifugation. Immunoprecipitations were performed using FLAG-specific monoclonal antibody (mAb) M2 covalently coupled agarose beads (Sigma). The immunoprecipitates were washed five times in lysis buffer, and proteins were eluted with 100 mm glycine, pH 3, and then neutralized with 110 volume of 1 m Tris, pH 8. Proteins were separated by SDS-PAGE or two-dimensional immobilized pH gradient (IPG)/SDS-PAGE (Amersham Biosciences, Inc.) as described (27Ji H. Reid G.E. Moritz R.L. Eddes J.S. Burgess A.W. Simpson R.J. Electrophoresis. 1997; 18: 605-613Crossref PubMed Scopus (49) Google Scholar). Immunoprecipitates were examined by Western blot analysis or autoradiography following transfer of proteins to nitrocellulose membranes (Hybond C-Extra; Amersham Biosciences, Inc.). mAbs used for Western blots were anti-FLAG M2 (Sigma), anti-HA High Affinity 3F10 (Roche Molecular Biochemicals), HtrA2-specific polyclonal antiserum (a kind gift of Dr. Emad Alnemri), cytochromec-specific mAb (7H8.2C12; Pharmingen), and anti-mouse DIABLO mAb 9H10 (Alexis). Proteins were visualized by ECL (Amersham Biosciences) following incubation of membranes with horseradish peroxidase-coupled secondary antibodies. For large scale preparation of XIAP-interacting proteins, FLAG-tagged XIAP was immunoprecipitated from transiently transfected 293 T cells by passing the lysate through a column of anti-FLAG antibody covalently coupled to agarose beads. Following extensive washing, FLAG-XIAP and co-immunoprecipitating proteins were eluted from the column using acid glycine (100 mm, pH 3) and then neutralized with a final concentration of 100 mm Tris, pH 8. Proteins were separated by two-dimensional IPG/SDS-PAGE as described (27Ji H. Reid G.E. Moritz R.L. Eddes J.S. Burgess A.W. Simpson R.J. Electrophoresis. 1997; 18: 605-613Crossref PubMed Scopus (49) Google Scholar) and detected by staining of the gel with Coomassie Phast-gel Blue R (Amersham Biosciences). Protein spots of interest were excised and digested in situ with 0.5 μg of trypsin (28Moritz R.L. Simpson R.J. J. Chromatogr. 1992; 599: 119-130Crossref PubMed Scopus (56) Google Scholar,29Moritz R.L. Eddes J.S. Reid G.E. Simpson R.J. Electrophoresis. 1996; 17: 907-917Crossref PubMed Scopus (92) Google Scholar). An electrospray ion trap mass spectrometer (model LCQ; Finnigan, San Jose, CA) coupled on-line with a capillary HPLC, Hewlett-Packard model 1090A modified for capillary chromatography (28Moritz R.L. Simpson R.J. J. Chromatogr. 1992; 599: 119-130Crossref PubMed Scopus (56) Google Scholar, 29Moritz R.L. Eddes J.S. Reid G.E. Simpson R.J. Electrophoresis. 1996; 17: 907-917Crossref PubMed Scopus (92) Google Scholar), was used for peptide sequencing. The 150 × 0.20-mm inner diameter capillary column used in this study (Brownlee RP-300; 7-μm C8) was fabricated using a polyvinylidene difluoride end (28Moritz R.L. Simpson R.J. J. Chromatogr. 1992; 599: 119-130Crossref PubMed Scopus (56) Google Scholar, 29Moritz R.L. Eddes J.S. Reid G.E. Simpson R.J. Electrophoresis. 1996; 17: 907-917Crossref PubMed Scopus (92) Google Scholar). A linear 60-min gradient (flow rate, 1.4 μl/min) from 0 to 100% B was used, where solvent A was 0.1% (v/v) aqueous trifluoroacetic acid and solvent B was 0.1% aqueous trifluoroacetic acid in 60% (v/v) acetonitrile. The electrospray ionization parameters were as follows: spray voltage, 4.5 kV; sheath and auxiliary gas flow rates, 5 and 30 (arbitrary values), respectively; capillary temperature, 150 °C; capillary voltage, 20 V; tube lens offset, 16 V. The sheath liquid used was 2-methoxyethanol (99.9% HPLC grade) delivered at a flow rate of 3 μl/min. The electron multiplier was set to −860 V. The ion trap automatic gain control parameter was turned on for all experiments, and this, coupled with a maximum injection time of 200 ms, ensured that the number of ions in the trap was automatically maintained at a constant preset value. All data were collected in centroid mode using a “double play” experiment. After the acquisition of a full mass spectrometry (MS) scan (350–2000 Da) in the first scan event, the most intense ion present above a preset threshold of 1 × 105 counts was isolated. In the second scan event, collision-induced dissociation tandem mass spectrometry (MS/MS) of the selected ion was performed. The collision energy for the MS/MS scan events was preset at a value of 55%. The sequences of uninterpreted collision-induced dissociation spectra were identified by either 1) de novo sequencing (i.e. manual interpretation of amino acid sequences via the elucidation of β- and y-type ion series (30Roepstorff P. Fohlman J. Biomed. Mass Spectrom. 1984; 11: 601-602Crossref PubMed Scopus (2424) Google Scholar)) or 2) the correlation with the peptide sequences present in the nonredundant protein sequence data base (OWL version 29.0) using the SEQUEST algorithm (version C1) incorporated into the Finnigan BIOWORKS™ software (version 1.0). The SEQUEST search results were assessed by examination of the Xcorr (cross-correlation) and δCn (δ normalized correlation) scores. The Xcorr function measures the similarity between the mass-to-charge ratios (m/z) for the fragment ions predicted from amino acid sequences obtained from the data base and the fragment ions observed in the MS/MS spectrum. The δCn score is obtained by normalizing the Xcorr values to 1.0 and observing the difference between the first- and second-ranked amino acid sequences. As a general rule, an Xcorr value of greater than 2.0 and a δCn greater than 0.1 was accepted as a positive identification. Manual inspection of each spectrum was performed to confirm the SEQUEST result. Recombinant XIAP was produced as previously described (25Silke J. Ekert P.G. Day C.L. Hawkins C.J. Baca M. Chew J. Pakusch M. Verhagen A.M. Vaux D.L. EMBO J. 2001; 20: 3114-3123Crossref PubMed Scopus (100) Google Scholar). In brief, GST-XIAP protein was produced in E. coli transformed with a vector encoding GST-XIAP (pGEX-6P-3 XIAP) and was affinity-purified on glutathione-Sepharose. XIAP was released by incubation of the resin with PreScission protease (Amersham Biosciences) in release buffer (50 mm Tris-HCl, 150 mm NaCl, 1 mmEDTA, 1 mm DTT, 0.01% Triton X-100, 1 mm DTT, pH 7) overnight at 4 °C. Recombinant mature DIABLO and mature HtrA2ΔPDZ were similarly generated in bacteria but with a C-terminal Hex-His tag. The proteins were purified on Ni2+-NTA-agarose beads (Qiagen) and released using imidazole release buffer (50 mm Na2HPO4, 300 mmNaCl, 250 mm imidazole). Recombinant mature HtrA2-FLAG was bacterially expressed and purified using anti-FLAG M2 affinity gel. HtrA2-FLAG was released using 100 mm glycine (pH 3) and immediately neutralized with 100 mm Tris, pH 8. The purity of all proteins were examined by SDS-PAGE followed by staining of the gel with Coomassie Blue, and protein concentrations were estimated by comparison with proteins of known concentration. Active caspase 3 was detected by cleavage of the fluorogenic substrate DEVD-AMC (Bachem). Caspase 3 (17 ng) was incubated in 1 × caspase cleavage buffer (0.05m HEPES, pH 7.5, 5% PEG4000, 0.05% CHAPS) in the presence or absence of XIAP (600 ng), mature recombinant DIABLO (500 ng), mature HtrA2ΔPDZ (200, 500, or 2000 ng), or BSA (500 ng) in a final volume of 45 μl. All sample mixes were equalized with imidazole release buffer, with these buffers contributing 10 μl of the final volume, respectively. Caspase 3 was added last to the mix after XIAP had been allowed to preincubate with IAP antagonists on ice for 15 min. The mixes were incubated for a further 15 min on ice after the addition of the caspase. The substrate DEVD-AMC was then added to a final concentration of 25 μm, and fluorescent emission, indicating substrate cleavage, was determined at 37 °C with 1-min intervals on a fluorimeter (Tecan) using excitation and emission filters of 360 and 465 nm, respectively. The proteolytic activity of purified bacterial mature HtrA2-FLAG and HtrA2ΔPDZ was detected by incubating different amounts of the HtrA2 proteins with 1.2 μg of β-casein (Roche Molecular Biochemicals) for 1 h at 37 °C in 50 mm Tris pH 8. Where indicated, HtrA2 was preincubated with an excess of XIAP for 15 min at 4 °C prior to the addition of β-casein. Reaction products were separated by SDS-PAGE, proteins were blotted onto polyvinylidene difluoride membranes (Millipore Corp.), and β-casein was visualized using an anti-milk antibody (Accurate). The teratocarcinoma cell line NT2 was grown in DMEM supplemented with 10% fetal calf serum, 1% penicillin/streptomycin, and 2% glutamine. Stable NT2 lines expressing FLAG-XIAP, Bcl-2, or LacZ have been previously described (8Ekert P.G. Silke J. Hawkins C.J. Verhagen A.M. Vaux D.L. J. Cell Biol. 2001; 152: 483-490Crossref PubMed Scopus (163) Google Scholar, 12Verhagen A.M. Ekert P.G. Pakusch M. Silke J. Connolly L.M. Reid G.E. Moritz R.L. Simpson R.J. Vaux D.L. Cell. 2000; 102: 43-53Abstract Full Text Full Text PDF PubMed Scopus (2001) Google Scholar). Cells were transfected as described above. Forty-eight hours post-transfection, the cells were left untreated or UV-irradiated (50 J/m2) and then returned to the incubator for 6 h before cell viability was assessed. Harvested cells were incubated with biotinylated annexin V (Molecular Probes, Inc., Eugene, OR) followed by incubation with Streptavidin-Tricolor (Caltag). GFP-positive cells were analyzed by flow cytometry for annexin V positivity as a measure of dead cells. Stable NT2 lines expressing FLAG-XIAP, Bcl-2, or LacZ have been previously described (8Ekert P.G. Silke J. Hawkins C.J. Verhagen A.M. Vaux D.L. J. Cell Biol. 2001; 152: 483-490Crossref PubMed Scopus (163) Google Scholar, 12Verhagen A.M. Ekert P.G. Pakusch M. Silke J. Connolly L.M. Reid G.E. Moritz R.L. Simpson R.J. Vaux D.L. Cell. 2000; 102: 43-53Abstract Full Text Full Text PDF PubMed Scopus (2001) Google Scholar). Cells were left untreated or UV-irradiated (50 J/m2), and membrane and cytosolic fractions were prepared 3 or 6 h post-UV using digitonin (8Ekert P.G. Silke J. Hawkins C.J. Verhagen A.M. Vaux D.L. J. Cell Biol. 2001; 152: 483-490Crossref PubMed Scopus (163) Google Scholar, 12Verhagen A.M. Ekert P.G. Pakusch M. Silke J. Connolly L.M. Reid G.E. Moritz R.L. Simpson R.J. Vaux D.L. Cell. 2000; 102: 43-53Abstract Full Text Full Text PDF PubMed Scopus (2001) Google Scholar). Briefly, NT2 cells were plated at 1.5 × 106 cells/10-cm plate and were UV-irradiated (50 J/m2) 0, 3, or 6 h prior to harvest as indicated. The cells were scraped off the plate and washed once with phosphate-buffered saline. They were then suspended in 200 μl of digitonin lysis buffer (0.025% digitonin in 250 mm sucrose, 20 mm HEPES, pH 7.4, 5 mm MgCl2, 10 mm KCl, 1 mm EDTA, 1 mm EGTA, 10 mm Tris, pH 7.4, 10 μg/ml aprotinin, 10 μg/ml leupeptin, and 1 mmphenylmethylsulfonyl fluoride). After 10 min, a brief centrifugation (2 min, maximum speed Eppendorf centrifuge) was performed, and the supernatant was removed (cytosolic fraction). The remaining pellet was resuspended in 200 μl of radioimmune precipitation assay lysis buffer (150 mm NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 50 mm Tris, pH 7.5), lysis was allowed to proceed for a further 30 min, and cellular debris was removed by centrifugation for 10 min in an Eppendorf centrifuge. The supernatant comprising the membrane fraction was retained. The presence of HtrA2 and cytochromec in the different fractions was established by Western blot analysis with HtrA2-specific polyclonal antiserum (a kind gift of Dr. Emad Alnemri) or cytochrome c-specific mAb (7H8.2C12; Pharmingen). NT2 cells were transiently transfected with pEFHtrA2-FLAG. 24 h post-transfection, the cells were initially incubated with MitoTracker Red (Molecular Probes) for 15 min before fixing and staining of the cells with anti-FLAG and a FITC-conjugated anti-mouse Ig secondary antibody. Confocal microscopy images were obtained in the green and red channels, and the images were overlaid to demonstrate the level of localization of HtrA2 in the mitochondria. 293 T cells were transiently transfected with a cDNA encoding murine XIAP with a carboxyl-terminal FLAG epitope tag (FLAG-XIAP). FLAG-XIAP immunoprecipitates prepared from35S-labeled cell lysates were examined by two-dimensional IPG/SDS-PAGE. As previously observed (12Verhagen A.M. Ekert P.G. Pakusch M. Silke J. Connolly L.M. Reid G.E. Moritz R.L. Simpson R.J. Vaux D.L. Cell. 2000; 102: 43-53Abstract Full Text Full Text PDF PubMed Scopus (2001) Google Scholar), four proteins specifically co-immunoprecipitated with FLAG-XIAP (Fig.1) 2In Figs. 1F, 2C, and 6 and in the text describing these figures, reference to amino acid 144 of muHtrA2 should read 134. that were not present in immunoprecipitates of a control FLAG-tagged protein (12Verhagen A.M. Ekert P.G. Pakusch M. Silke J. Connolly L.M. Reid G.E. Moritz R.L. Simpson R.J. Vaux D.L. Cell. 2000; 102: 43-53Abstract Full Text Full Text PDF PubMed Scopus (2001) Google Scholar). We previously detected an interaction of XIAP with DIABLO (protein spot 4) in mammalian NT2 cells stably expressing low levels of N-terminally FLAG-tagged XIAP. In immunoprecipitates of XIAP from a newly generated NT2 cell line stably expressing higher levels of FLAG-XIAP, protein spot 2 could also be detected (Fig.1B). To identify protein 2, cellular lysates prepared from 40 × 15-cm Petri dishes of 293T cells transiently transfected with FLAG-XIAP were passed through a column of anti-FLAG antibody-coupled agarose beads. After extensive washing, the bound proteins were eluted with acidic glycine and separated by two-dimensional IPG/SDS-PAGE (Fig.1C). A Coomassie-stained spot corresponding to protein 2 was extracted from the gel and subjected to electrospray tandem mass spectrometry (Fig. 1D). The peptide sequences recovered were used to search DNA data bases using TFASTA and TBLAST. Highly significant matches were found with human and mouse sequences, identifying spot 2 as human HtrA2/Omi (AF020760), a recently described mammalian homologue of the E. coli heat shock-inducible serine protease HtrA (19Faccio L. Fusco C. Chen A. Martinotti S. Bonventre J.V. Zervos A.S. J. Biol. Chem. 2000; 275: 2581-2588Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, 20Gray C.W. Ward R.V. Karran E. Turconi S. Rowles A. Viglienghi D. Southan C. Barton A. Fantom K.G. West A. Savopoulos J. Hassan N.J. Clinkenbeard H. Hanning C. Amegadzie B. Davis J.B. Dingwall C. Livi G.P. Creasy C.L. Eur. J. Biochem. 2000; 267: 5699-5710Crossref PubMed Scopus (237) Google Scholar). Human HtrA2, a 458-amino acid protein with a predicted molecular mass of 49 kDa and a pI of 9.5, possesses a putative transmembrane domain, a conserved serine protease domain, and a single C-terminal PDZ domain. Two overlapping murine IMAGE consortium expressed sequence tag clones (accession numbers AA171302 and AA498607) were obtained from Research Genetics that together encompass a 1630-bp cDNA encoding a 458-amino acid protein with a predicted mass of 49.4 kDa and pI of 9.7 (Fig. 1E). The peptide regions identified by mass spectrometric analysis of protein 2 correspond to sequences encoded by this cDNA. An apparent allelic variation in the mouse protein occurs at position 449 that can be either threonine (AA171302) or leucine (AA498607). Mouse HtrA has
