Although it is well established that reactive oxygen intermediates mediate the NF-κB activation induced by most agents, how H2O2 activates this transcription factor is not well understood. We found that treatment of human myeloid KBM-5 cells with H2O2 activated NF-κB in a dose- and time-dependent manner much as tumor necrosis factor (TNF) did but unlike TNF, H2O2 had no effect on IκBα degradation. Unexpectedly, however, like TNF-induced activation, H2O2-induced NF-κB activation was blocked by the calpain inhibitor N-Ac-Leu-Leu-norleucinal, suggesting that a proteosomal pathway was involved. Although H2O2 activated IκBα kinase, it did not induce the serine phosphorylation of IκBα. Like TNF, H2O2 induced the serine phosphorylation of the p65 subunit of NF-κB, leading to its nuclear translocation. We found that H2O2 induced the tyrosine phosphorylation of IκBα, which is needed for NF-κB activation. We present several lines of evidence to suggest that the Syk protein-tyrosine kinase is involved in H2O2-induced NF-κB activation. First, H2O2 activated Syk in KBM-5 cells; second, H2O2 failed to activate NF-κB in cells that do not express Syk protein; third, overexpression of Syk increased H2O2-induced NF-κB activation; and fourth, reduction of Syk transcription using small interfering RNA inhibited H2O2-induced NF-κB activation. We also showed that Syk induced the tyrosine phosphorylation of IκBα, which caused the dissociation, phosphorylation, and nuclear translocation of p65. Thus, overall, our results demonstrate that H2O2 induces NF-κB activation, not through serine phosphorylation or degradation of IκBα, but through Syk-mediated tyrosine phosphorylation of IκBα Although it is well established that reactive oxygen intermediates mediate the NF-κB activation induced by most agents, how H2O2 activates this transcription factor is not well understood. We found that treatment of human myeloid KBM-5 cells with H2O2 activated NF-κB in a dose- and time-dependent manner much as tumor necrosis factor (TNF) did but unlike TNF, H2O2 had no effect on IκBα degradation. Unexpectedly, however, like TNF-induced activation, H2O2-induced NF-κB activation was blocked by the calpain inhibitor N-Ac-Leu-Leu-norleucinal, suggesting that a proteosomal pathway was involved. Although H2O2 activated IκBα kinase, it did not induce the serine phosphorylation of IκBα. Like TNF, H2O2 induced the serine phosphorylation of the p65 subunit of NF-κB, leading to its nuclear translocation. We found that H2O2 induced the tyrosine phosphorylation of IκBα, which is needed for NF-κB activation. We present several lines of evidence to suggest that the Syk protein-tyrosine kinase is involved in H2O2-induced NF-κB activation. First, H2O2 activated Syk in KBM-5 cells; second, H2O2 failed to activate NF-κB in cells that do not express Syk protein; third, overexpression of Syk increased H2O2-induced NF-κB activation; and fourth, reduction of Syk transcription using small interfering RNA inhibited H2O2-induced NF-κB activation. We also showed that Syk induced the tyrosine phosphorylation of IκBα, which caused the dissociation, phosphorylation, and nuclear translocation of p65. Thus, overall, our results demonstrate that H2O2 induces NF-κB activation, not through serine phosphorylation or degradation of IκBα, but through Syk-mediated tyrosine phosphorylation of IκBα Nuclear factor-κB (NF-κB) 1The abbreviations used are: NF-κB, nuclear factor kappa B; IκB, inhibitory subunit of NF-κB; IKK, IκBα kinase; TNF, tumor necrosis factor; Syk, spleen tyrosine kinase; p56lck, lymphocyte-specific protein-tyrosine kinase; EMSA, electrophoretic mobility shift assay; ALLN, N-acetyl-leucyl-leucyl-norleucinal; siRNA, small interfering RNA. is a transcription factor consisting of a group of five proteins, namely c-Rel, RelA (p65), Rel B, NF-κB1 (p50 and p105), and NF-κB2 (p52) (1Ghosh S. Karin M. Cell. 2002; 109: S81-S96Google Scholar). In the resting state, NF-κB is sequestered in the cytoplasm through its tight association with specific inhibitory proteins, called inhibitors of NF-κB (IκB), belonging to a gene family consisting of IκBα, IκBβ, IκBϵ, IκBγ, Bcl-3, p100, and p105 (1Ghosh S. Karin M. Cell. 2002; 109: S81-S96Google Scholar). On activation by agents such as TNF, IκBα is phosphorylated at serine residues 32 and 36, ubiquitinated at lysine residues 21 and 22, and degraded through the proteosomal pathway, thus exposing the nuclear localization signals on the p50-p65 heterodimer. Then p65 undergoes phosphorylation, leading to nuclear translocation and binding to a specific sequence in DNA, which in turn results in gene transcription. The phosphorylation of IκBα is catalyzed by IκBα kinase (IKK), which consists of IKK-α, IKK-β, and IKK-γ (also called NF-κB essential modulator (NEMO)) (1Ghosh S. Karin M. Cell. 2002; 109: S81-S96Google Scholar). Gene deletion studies have established that IKK-β is essential for NF-κB activation by TNF (2Li Z.W. Chu W. Hu Y. Delhase M. Deerinck T. Ellisman M. Johnson R. Karin M. J. Exp. Med. 1999; 189: 1839-1845Google Scholar, 3Li Q. Estepa G. Memet S. Israel A. Verma I.M. Genes Dev. 2000; 14: 1729-1733Crossref Google Scholar, 4Li Q. Antwerp D.V. Mercurio F. Lee K.F. Verma I.M. Science. 1999; 284: 321-325Google Scholar). IKK-α deletion, however, has no effect on NF-κB activation by most agents. Which kinase induces the phosphorylation of p65 is controversial, but protein kinase A, casein kinase II, IKK-α, and IKK-β have all been implicated (5Hayashi T. Sekine T. Okamoto T. J. Biol. Chem. 1993; 268: 26790-26795Google Scholar, 6Zhong H. SuYang H. Erdjument-Bromage H. Tempst P. Ghosh S. Cell. 1997; 89: 413-424Google Scholar, 7Zhong H. Voll R.E. Ghosh S. Mol. Cell. 1998; 1: 661-671Google Scholar, 8Wang D. Westerheide S.D. Hanson J.L. Baldwin Jr., A.S. J. Biol. Chem. 2000; 275: 32592-32597Google Scholar, 9Sakurai H. Chiba H. Miyoshi H. Sugita T. Toriumi W. J. Biol. Chem. 1999; 274: 30353-30356Google Scholar, 10Sizemore N. Lerner N. Dombrowski N. Sakurai H. Stark G.R. J. Biol. Chem. 2002; 277: 3863-3869Google Scholar). The phosphorylation of p65 at serine 529 has been shown to be required for the TNF-induced transcriptional activity of NF-κB (11Wang D. Baldwin Jr., A.S. J. Biol. Chem. 1998; 273: 29411-29416Google Scholar). NF-κB is activated by a wide variety of agents, including all 18 members of the TNF superfamily, interleukin-1, interleukin-17, interleukin-18, lipopolysaccharide, H2O2, ceramide, phorbol esters, growth factors, UV, X-rays, and γ-radiation (12Garg A. Aggarwal B.B. Leukemia. 2002; 16: 1053-1068Google Scholar). Whether all these agents activate NF-κB through the same pathway as described above is not clear. Certain agents activate NF-κB not through serine phosphorylation but through tyrosine phosphorylation of IκBα: nerve growth factor, erythropoietin, pervanadate, hypoxia, and silica (13Bui N.T. Livolsi A. Peyron J.F. Prehn J.H. J. Cell Biol. 2001; 152: 753-764Google Scholar, 14Digicaylioglu M. Lipton S.A. Nature. 2001; 412: 641-647Google Scholar, 15Imbert V. Rupec R.A. Livolsi A. Pahl H.L. Traenckner E.B. Mueller-Dieckmann C. Farahifar D. Rossi B. Auberger P. Baeuerle P.A. Peyron J.F. Cell. 1996; 86: 787-798Google Scholar, 16Singh S. Darnay B.G. Aggarwal B.B. J. Biol. Chem. 1996; 271: 31049-31054Google Scholar, 17Kang J.L. Pack I.S. Hong S.M. Lee H.S. Castranova V. Toxicol. Appl. Pharmacol. 2000; 169: 59-65Google Scholar, 18Koong A.C. Chen E.Y. Giaccia A.J. Cancer Res. 1994; 54: 1425-1430Google Scholar). The tyrosine phosphorylation of IκBα by most agents does not lead to IκBα degradation. Pervanadate-induced NF-κB activation, however, leads to tyrosine phosphorylation and degradation of IκBα (19Mukhopadhyay A. Manna S.K. Aggarwal B.B. J. Biol. Chem. 2000; 275: 8549-8555Google Scholar). Surprisingly, UV-C-induced NF-κB activation is mediated through the degradation of IκBα that involves phosphorylation of neither serine nor the tyrosine residue of IκBα (20Li N. Karin M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13012-13017Google Scholar). Pervanadate-induced tyrosine phosphorylation of IκBα blocks the TNF-induced serine phosphorylation of IκBα and NF-κB activation (16Singh S. Darnay B.G. Aggarwal B.B. J. Biol. Chem. 1996; 271: 31049-31054Google Scholar, 21Singh S. Aggarwal B.B. J. Biol. Chem. 1995; 270: 10631-10639Google Scholar), indicating potential stereochemical hindrance. NF-κB activation of most agents has been shown to require the generation of reactive oxygen intermediates, in studies that used either reactive oxygen intermediate quenchers, such as N-acetylcysteine, or antioxidant enzymes, such as glutathione peroxidase, superoxide dismutase, γ-glutamylcysteine synthetase, and thioredoxin (22Staal F.J. Roederer M. Herzenberg L.A. Herzenberg L.A. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 9943-9947Google Scholar, 23Kretz-Remy C. Mehlen P. Mirault M.E. Arrigo A.P. J. Cell Biol. 1996; 133: 1083-1093Google Scholar, 24Schreck R. Rieber P. Baeuerle P.A. EMBO J. 1991; 10: 2247-2258Google Scholar, 25Giri D.K. Aggarwal B.B. J. Biol. Chem. 1998; 273: 14008-14014Google Scholar, 26Manna S.K. Zhang H.J. Yan T. Oberley L.W. Aggarwal B.B. J. Biol. Chem. 1998; 273: 13245-13254Google Scholar, 27Manna S.K. Kuo M.T. Aggarwal B.B. Oncogene. 1999; 18: 4371-4382Google Scholar, 28Shrivastava A. Aggarwal B.B. Antioxid Redox Signal. 1999; 1: 181-191Google Scholar, 29Matthews J.R. Wakasugi N. Virelizier J.L. Yodoi J. Hay R.T. Nucleic Acids Res. 1992; 20: 3821-3830Google Scholar). Additionally, there are reports that H2O2 activates NF-κB (23Kretz-Remy C. Mehlen P. Mirault M.E. Arrigo A.P. J. Cell Biol. 1996; 133: 1083-1093Google Scholar, 24Schreck R. Rieber P. Baeuerle P.A. EMBO J. 1991; 10: 2247-2258Google Scholar, 30Meyer M. Schreck R. Baeuerle P.A. EMBO J. 1993; 12: 2005-2015Google Scholar). Although it has been shown that H2O2-induced NF-κB is blocked by N-acetylcysteine (24Schreck R. Rieber P. Baeuerle P.A. EMBO J. 1991; 10: 2247-2258Google Scholar), how H2O2 activates NF-κB is not fully understood (31Livolsi A. Busuttil V. Imbert V. Abraham R.T. Peyron J.F. Eur. J. Biochem. 2001; 268: 1508-1515Google Scholar, 32Schoonbroodt S. Ferreira V. Best-Belpomme M. Boelaert J.R. J. Immunol. 2000; 164: 4292-4300Google Scholar, 33Kamata H. Manabe T. Oka S. Kamata K. Hirata H. FEBS Lett. 2002; 519: 231-237Google Scholar). In the present report, we investigated the mechanism of H2O2-induced NF-κB activation. We found that H2O2-induced NF-κB activation occurred without degradation of IκBα. Instead, H2O2 activated Syk protein-tyrosine kinase, which in turn induced tyrosine phosphorylation of IκBα, leading to NF-κB activation. Reagents—Bacteria-derived human rTNF, purified to homogeneity with a specific activity of 5 × 107 units/mg, was kindly provided by Genentech (South San Francisco, CA). Penicillin, streptomycin, Iscove's modified Dulbecco's medium, RPMI 1640 medium, fetal bovine serum, and LipofectAMINE 200 were obtained from Invitrogen. H2O2 was obtained from Sigma. Antibodies anti-p65, anti-p50, anti-IκBα, anti-cyclin D1, and anti-phosphotyrosine (PY99) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Phospho-specific anti-IκBα (Ser-32) antibody was purchased from Cell Signaling (Beverly, MA). Anti-IKK-α and anti-IKK-β antibodies were kindly provided by Imgenex (San Diego, CA). Anti-Syk and anti-phosphotyrosine (4G10) antibodies were purchased from Neo markers (Fremont, CA). Antibody that recognizes the serine 529-phosphorylated form of p65 was obtained from Rockland Laboratories (Gilberts-ville, PA). Wild type Syk-cDNA as described previously (34Coopman P.J. Do M.T. Barth M. Bowden E.T. Hayes A.J. Basyuk E. Blancato J.K. Vezza P.R. McLeskey S.W. Mangeat P.H. Mueller S.C. Nature. 2000; 406: 742-747Google Scholar), was kindly provided by Dr. Susette C. Mueller (Georgetown University Medical School, Washington, D. C.). Generation of siRNA Plasmid Vector—IMG-800 (pSuppressorNeo, Imgenex, CA) vector was used for construction of 21-bp head-to-head hairpins of human Syk (GenBank™ accession number NM 003177.2, bp 153–173, 555–575, or 1443–1463). For each construction, two complementary oligonucleotides containing human Syk sequences were synthesized (MWG-Biotech, High point, NC) and annealed to generate double stranded DNAs, which were cloned into the SalI and XbaI cloning sites of IMG-800. The sequence (bp 555–575) used was TCGAGCAGACATGGAA CCTGCAGGGGAGTACTGCCCTGCAGGTTCCATGTCTGCTTTTT (sequences are in bold letter, stem loop sequences are in italics, and SalI cloning overhang site is underlined). Cell Lines—The leukemic cell line KBM-5 is phenotypically myeloid with monocytic differentiation. The cell lines Jurkat (human T cells), JCaM1 (p56lck and p72syk deficient), human breast cancer cells MCF-7, human lung cancer cells H1299 and mouse macrophage RAW 264.7 cells were obtained from the American Tissue and Cell Culture Collection (ATCC, Rockville, MD). JCaM1 cells transfected with the p56lck gene were kindly supplied by Dr. Arthur Weiss (The University of California, San Francisco, CA). The characterization of these cells has been previously reported (35Straus D.B. Weiss A. Cell. 1992; 70: 585-593Google Scholar). KBM-5 cells were cultured in Iscove's modified Dulbecco's medium supplemented with 15% fetal bovine serum; Jurkat and JCaM1 cells were cultured in RPMI 1640 medium with 10% fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin. Electrophoretic Mobility Shift Assays (EMSA)—To determine NF-κB activation, we performed EMSA as described (36Chaturvedi M.M. Mukhopadhyay A. Aggarwal B.B. Methods Enzymol. 2000; 319: 585-602Google Scholar). Briefly, nuclear extracts prepared from TNF-treated cells (2 × 106/ml) were incubated with 32P-end-labeled 45-mer double-stranded NF-κB oligonucleotide (10 μg of protein with 16 fmol of DNA) from the human immunodeficiency virus long terminal repeat, 5′-TTGTTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGG-3′ (boldface indicates NF-κB binding sites) for 30 min at 37 °C, and the DNA-protein complex formed was separated from free oligonucleotide on 6.6% native polyacrylamide gels. A double-stranded mutated oligonucleotide, 5′-TTGTTACAACTCACTTTCCGCTGCTCACTTTCCAGGGAGGCGTGG-3′, was used to examine the specificity of binding of NF-κB to the DNA. The specificity of binding was also examined by competition with the unlabeled oligonucleotide. For supershift assays, nuclear extracts prepared from TNF-treated cells were incubated with antibodies against either p50 or p65 of NF-κB for 30 min at 37 °C before the complex was analyzed by EMSA. Antibodies against cyclin D1 and preimmune serum were included as negative controls. The dried gels were visualized, and radioactive bands quantitated by a PhosphorImager (Amersham Biosciences) using ImageQuant software. Western Blot Analysis—To determine the levels of protein expression in cytoplasm or nuclear extracts, we prepared each extract (37Majumdar S. Aggarwal B.B. J. Immunol. 2001; 167: 2911-2920Google Scholar) from TNF-treated cells and fractionated them by SDS-PAGE. After electrophoresis, the proteins were electrotransferred to nitrocellulose membranes, blotted with each antibody, and detected by ECL regent (Amersham Biosciences). The density of the bands was measured using a personal densitometer scan v1.30 and ImageQuant software version 3.3 (Amersham Biosciences). IκBα Kinase Assay—The IKK assay was performed by a method described previously (38Manna S.K. Mukhopadhyay A. Aggarwal B.B. J. Immunol. 2000; 165: 4927-4934Google Scholar). Briefly, IKK complex from cytoplasm was precipitated with antibody against IKK-α, followed by treatment with protein A/G-Sepharose beads (Pierce). After a 2-h incubation, the beads were washed with lysis buffer and then assayed in kinase assay mixture containing 50 mm HEPES (pH 7.4), 20 mm MgCl2, 2 mm dithiothreitol, 20 μCi of [γ-32P]ATP, 10 μm unlabeled ATP, and 2 μg of substrate GST-IκBα-(1–54). After the immunocomplex was incubated at 30 °C for 30 min, the reaction was terminated by boiling with SDS sample buffer for 5 min. Finally, the protein was resolved on 10% SDS-PAGE, the gel was dried, and the radioactive bands were visualized by PhosphorImager. To determine the total amounts of IKK-α and IKK-β in each sample, 30 μg of the cytoplasmic protein was resolved on 7.5% SDS-PAGE, electrotransferred to a nitrocellulose membrane, and then blotted with either anti-IKK-α or anti-IKK-β antibodies. Syk Kinase Assay—To examine the activity of protein-tyrosine kinase Syk induced by H2O2, we immunoprecipitated with anti-Syk antibody, and then performed the in vitro kinase assay using the GST-IκBα-(1–54) as the substrate. Briefly, cells were pretreated with 100 μg/ml ALLN (to prevent proteolytic degradation; Ref. 39Bharti A.C. Donato N. Singh S. Aggarwal B.B. Blood. 2003; 101: 1053-1062Google Scholar) for 1 h, then stimulated with H2O2 for 5 min and whole cell extracts were prepared in the lysis buffer (1% Triton X-100, 1 mm phenylmethanesulfonyl fluoride, 20 μg/ml leupeptin, 5 mm sodium orthovanadate, and 2 mm EDTA). The kinase protein was immunoprecipitated using anti-Syk antibody, followed by protein A/G-Sepharose beads. After 2 h, the beads were washed with the lysis buffer and assayed in a kinase assay mixture containing 50 mm HEPES (pH 7.4), 50 mm MgCl2,5mm sodium orthovanadate, 10 μm unlabeled ATP, and 5 μg of substrate GST-IκBα-(1–54)) and [γ-32P]ATP. After 30 min incubation at 30 °C, the samples were boiled with SDS sample buffer for 5 min, then subjected to polyacrylamide gel electrophoresis under denaturing conditions (10% SDS-PAGE), and the dried gels were visualized, and radioactive bands quantitated by a PhosphorImager using ImageQuant software. The tyrosine phosphorylation of IκBα by Syk was also determined by using unlabeled ATP in the kinase reaction mixture as described above, and then performing Western blot analysis using anti-phosphotyrosine antibody. Nuclear Localization of p65 NF-κB by Immunocytochemistry—The effect of H2O2 on the nuclear translocation of p65 was examined by the immunocytochemical method as described (40Vinitsky A. Michaud C. Powers J.C. Orlowski M. Biochemistry. 1992; 31: 9421-9428Google Scholar). Briefly, treated cells were plated on a poly-l-lysine-coated glass slide by centrifugation using a cytospin 4 (Thermoshendon, Pittsburg, PA), air-dried, fixed with cold acetone, and permeabilized with 0.2% of Triton X-100. After being washed in phosphate-buffered saline, slides were blocked with 5% normal goat serum for 1 h and then incubated with rabbit polyclonal anti-human p65 or IκBα antibodies at 1:100 dilutions. After overnight incubation at 4 °C, the slides were washed, incubated with goat anti-rabbit IgG-Alexa 594 (Molecular Probes, Eugene, OR) at 1:100 dilutions for 1 h, and counterstained for nuclei with Hoechst 33342 (50 ng/ml) for 5 min. Stained slides were mounted with mounting medium purchased from Sigma and analyzed under a fluorescence microscope (Labophot-2, Nikon, Tokyo, Japan). Pictures were captured using Photometrics Coolsnap CF color camera (Nikon, Lewisville, TX) and MetaMorph version 4.6.5 software (Universal Imaging, Downingtown, PA). Immunoprecipitation Assays—Cells were lysed for 30 min on ice in whole cell extraction buffer (20 mm HEPES, pH 7.9, 50 mm NaCl, 1% Nonidet P-40, 2 mm EDTA, 0.5 mm EGTA, 2 μg/ml aprotinin, 2 μg/ml leupeptin, 0.5 mm phenylmethanesulfonyl fluoride, and 2 mm sodium orthovanadate). Lysate containing 500 μg of proteins in extraction buffer was incubated with 1 μg/ml concentration of antibodies overnight. Immunocomplex was precipitated using protein A/G-Sepharose beads for 1 h at 4 °C. Beads were washed with extraction buffer and resuspended in SDS sample buffer, boiled for 5 min, and fractionated in SDS-PAGE. Syk-siRNA and Syk-cDNA Transfection—To determine the role of Syk protein-tyrosine kinase in the H2O2-induced NF-κB activation, 2 × 105 cells were transfected either with small interfering RNA-Syk (siRNA-Syk), or with wild type-Syk cDNA (Syk-WT). Two μg of plasmid in each case was diluted in 200 μl of Dulbecco's modified Eagle's medium (without serum and antibiotics), and then mixed with 200 μlof Dulbecco's modified Eagle's medium containing 4 μl of LipofectAMINE 2000. This mixture was added to the cells and incubated for 4 h. After incubation, medium was changed into RPMI 1640 and maintained for an additional 48 h. These cells were then used to examine the expression of Syk protein by Western blot analysis, NF-κB activity by EMSA, and Syk activity by the kinase assay as described above. In this report we investigated the effect of H2O2 on NF-κB activation, IκBα phosphorylation, IκBα degradation, p65 phosphorylation, and nuclear translocation, and the role of protein-tyrosine kinase Syk in H2O2-induced NF-κB activation. Because NF-κB activation by TNF is well understood, we used TNF as a control for most studies. As determined by trypan blue dye exclusion and Hoechst staining methods, the treatment of cells with 500 μm H2O2 for 2 h had no significant effect on cell viability (viability was greater than 98%). Both H2O2and TNF Activate DNA Binding Activity of NF-κB in a Dose- and Time-dependent Manner—To determine the effect of H2O2 on the activation of NF-κB, KBM-5 cells were treated with different concentrations of H2O2 for 120 min or TNF for 30 min. Nuclear extracts were prepared for analysis of NF-κB activation by EMSA. Both H2O2 and TNF induced NF-κB activation in a dose-dependent manner in KBM-5 cells (Fig. 1A); maximum activation with H2O2 occurred at 500 μm. NF-κB was activated by both agents in a time-dependent manner (Fig. 1B). TNF induced NF-κB activation within 15 min, and activation continued for 240 min, whereas, H2O2-induced NF-κB activation started at 60 min, reached maximum at 120 min, and then decreased at 240 min. The maximum TNF-induced NF-κB activation was 14-fold; with H2O2 it was 3–7-fold. Thus, H2O2 induced NF-κB activation more slowly than did TNF. The slower kinetics and difference in the optimum level of activation suggest that the mechanism of NF-κB activation by H2O2 is different from that of TNF. Because NF-κB is a complex of proteins, various combinations of Rel/NF-κB protein can constitute an active NF-κB heterodimer that binds to a specific sequence in DNA (1Ghosh S. Karin M. Cell. 2002; 109: S81-S96Google Scholar). To show that the retarded band visualized by EMSA in H2O2-treated cells was indeed NF-κB, we incubated nuclear extracts from H2O2-stimulated cells with antibodies to either the p50 (NF-κB1) or the p65 (RelA) subunit of NF-κB. Both shifted the band to a higher molecular mass (Fig. 1C), thus suggesting that the H2O2-activated complex consisted of p50 and p65 subunits. Neither preimmune serum nor anti-cyclin D1 antibody had any effect. Excess unlabeled NF-κB (100-fold) caused complete disappearance of the band, and a mutant oligonucleotide of NF-κB did not affect NF-κB binding activity. H2O2Induces NF-κB Activation without Degrading IκBα— TNF-induced NF-κB activation requires the degradation of IκBα (for references see Ref. 1Ghosh S. Karin M. Cell. 2002; 109: S81-S96Google Scholar). Whether H2O2-induced NF-κB activation is also mediated through IκBα degradation was investigated. To determine this, cells were treated with 0.1 nm TNF or 500 μm H2O2 for the indicated times, extracted the cytoplasmic protein, and analyzed for IκBα on 10% SDS-PAGE using anti-IκBα antibody. TNF induced IκBα degradation within 15 min after treatment, and IκBα was resynthesized at 60 min (Fig. 2A). However, H2O2 did not induce IκBα degradation at any time points. TNF Induces IκB Serine Phosphorylation but H2O2Does Not—TNF induces phosphorylation of serines 32 and 36 of IκBα (for references see Ref. 1Ghosh S. Karin M. Cell. 2002; 109: S81-S96Google Scholar). So we investigated whether H2O2 induces serine phosphorylation of IκBα. To stabilize the phosphorylated IκBα, we blocked degradation of IκBα using the proteosome inhibitor ALLN (39Bharti A.C. Donato N. Singh S. Aggarwal B.B. Blood. 2003; 101: 1053-1062Google Scholar). Western blot analysis using phospho-specific anti-IκBα antibody (Fig. 2B) showed that TNF induced the phosphorylation of IκBα but H2O2 had no effect on the serine phosphorylation of IκBα. ALLN Inhibits NF-κB Activation Induced by Both TNF and H2O2—ALLN blocked not only TNF-induced NF-κB activation, but also H2O2-induced NF-κB activation (Fig. 2C). Thus IκBα phosphorylation and degradation are critical in TNF-induced NF-κB activation. H2O2Induces Translocation and Phosphorylation of p65—We analyzed the effect of TNF and H2O2 on translocation and phosphorylation of p65 by Western blot analysis. Both TNF and H2O2 induced nuclear translocation of p65 in a time-dependent manner. On TNF stimulation, p65 nuclear translocation reached maximum 15 min after TNF treatment and gradually declined thereafter. In the case of H2O2, p65 translocation was slightly induced after 15 min treatment, peaked at 60 min, and diminished thereafter (Fig. 3A). Both TNF and H2O2 induced the phosphorylation of p65 in a time-dependent manner, but the kinetics of H2O2-induced phosphorylation of p65 was slower than that for TNF (Fig. 3B). Immunocytochemistry assay showed that while in untreated cells, p65 was localized primarily in the cytoplasm, TNF and H2O2 induced translocation of p65 into the nucleus (Fig. 3C). However, H2O2-induced phosphorylation and translocation of p65 to the nucleus were delayed compared with TNF-induced response. H2O2Induces IκBα Kinase Activation—Because our results indicated that H2O2-induced NF-κB activation is not mediated through the phosphorylation and degradation of IκBα, we next explored whether H2O2 can activate IKK. It has been shown that IKK is required not only for TNF-induced phosphorylation of IκBα but also for the phosphorylation of p65 (9Sakurai H. Chiba H. Miyoshi H. Sugita T. Toriumi W. J. Biol. Chem. 1999; 274: 30353-30356Google Scholar, 10Sizemore N. Lerner N. Dombrowski N. Sakurai H. Stark G.R. J. Biol. Chem. 2002; 277: 3863-3869Google Scholar). An in vitro immune complex kinase assay using GST-IκBα-(1–54) as the substrate showed that both TNF and H2O2 activated IKK as early as 5 min after TNF treatment, but then activation ceased (Fig. 4). H2O2-induced IKK activation was, however, weaker than that induced by TNF. Neither TNF nor H2O2 had any effect on the expression of either IKK-α or IKK-β proteins. These results suggest that H2O2 activated IKK but had no effect on the serine phosphorylation of IκBα. H2O2Does Not Activate NF-κB in Syk-deficient Jurkat Cells—To investigate further the role of Syk in H2O2-induced NF-κB activation, we used JCaM1 cells known to lack both Lck (35Straus D.B. Weiss A. Cell. 1992; 70: 585-593Google Scholar) and Syk protein expression (41Willebrand V.M. Williams S. Tailor S. Mustelin T. Cell Signalling. 1998; 10: 407-413Google Scholar). Western blot analysis revealed that Jurkat cells expressed Syk protein but JCaM1 cells expressed very little or no Syk (Fig. 5A). The anti-Syk antibody was specific as it did not recognize Lck protein expression in p56lck-reconstituted JCaM1 cells (Fig. 5A). TNF activated NF-κB in both Jurkat and JCaM1 cells and induced IκBα degradation in both the cell lines (Fig. 5B). The kinetics of TNF-induced NF-κB activation, however, was slightly slower in JCaM1 cells than in Jurkat cells (15 versus 30 min) and the overall magnitude of activation was also lower (7.1-versus 5.1-fold). In contrast, H2O2 activated NF-κB in Jurkat cells but not in JCaM1 cells (Fig. 5C), indicating an essential role of Syk protein expression in H2O2-induced activation. We also investigated the ability of H2O2 to activate NF-κB in human lung epithelial (H1299) and breast epithelial (MCF-7) cells, which cannot be activated for Syk (Fig. 5D, lower panel). H1299 and MCF-7 cells were treated with H2O2 for the indicated times, nuclear extracts were prepared and analyzed for NF-κB activation by EMSA. Whole cell extracts were analyzed for Syk activation. We found that H2O2 failed to activate Syk and this correlated with the lack of activation of NF-κB in H1299 and MCF-7 cells. Whether H2O2 can activate NF-κB in murine cells was examined. For this murine macrophage RAW264.7 cells were treated for the indicated times with 500 μm H2O2 and then examined for NF-κB activation by EMSA and IκBα degradation by Western blot analysis. As shown in Fig. 5E, H2O2 induced NF-κB activation in murine cells and this was accompanied with the degradation and resynthesis of IκBα. These results agree with a previous report (32Schoonbroodt S. Ferreira V. Best-Belpomme M. Boelaert J.R. J. Immunol. 2000; 164: 4292-4300Google Scholar) but differ from that noted in human cells. H2O2Does Not Activate NF-κB in Lck-reconstituted JCaM1 Cells—JCaM1 cells have been shown to lack both p56lck and Syk protein-tyrosine kinases (35Straus D.B. Weiss A. Cell. 1992; 70: 585-593Google Scholar). Previously we have shown that p56lck is required for ceramide-induced and HIV-tat-induced NF-κB activation (42Manna S.K. Sah N.K. Aggarwal B.B. J. Biol. Chem. 2000; 275: 13297-13306Google Scholar, 43Manna S.K. Aggarwal B.B. J. Immunol. 2000; 164: 5166Google Scholar). EMSA of JCaM1 cells whose p56lck expression had been reconstituted revealed that H2O2 activated NF-κB in Jurkat cells but not in JCaM1 cells whose p56lck expression had been reconstituted (Fig. 5F). No IκBα phosphorylation was noted in either of the cell lines (see lower panel). In other words, p56lck was not required for H2O2-induced NF-κB activation or for IκBα phosphorylation. H2O2Induces Tyrosine Phosphorylation of Syk Protein in Jurkat Cells but Not in JCaM1 Cells—Jurkat and Syk-deficient JCaM1 cells treated with H2O2 for the indicated times were immunoprecipitated with anti-Syk antibody and then subjected to Western blot analysis using anti-phosphotyrosine antibody (4G10)
