Autism spectrum disorders (ASD) are a group of related neurodevelopmental syndromes with complex genetic etiology.1Gupta A.R. State M.W. Recent advances in the genetics of autism.Biol. Psychiatry. 2007; 61: 429-437Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar We identified a de novo chromosome 7q inversion disrupting Autism susceptibility candidate 2 (AUTS2) and Contactin Associated Protein-Like 2 (CNTNAP2) in a child with cognitive and social delay. We focused our initial analysis on CNTNAP2 based on our demonstration of disruption of Contactin 4 (CNTN4) in a patient with ASD;2Fernandez T. Morgan T. Davis N. Klin A. Morris A. Farhi A. Lifton R.P. State M.W. Disruption of contactin 4 (CNTN4) results in developmental delay and other features of 3p deletion syndrome.Am. J. Hum. Genet. 2004; 74: 1286-1293Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar the recent finding of rare homozygous mutations in CNTNAP2 leading to intractable seizures and autism;3Strauss K.A. Puffenberger E.G. Huentelman M.J. Gottlieb S. Dobrin S.E. Parod J.M. Stephan D.A. Morton D.H. Recessive symptomatic focal epilepsy and mutant contactin-associated protein-like 2.N. Engl. J. Med. 2006; 354: 1370-1377Crossref PubMed Scopus (454) Google Scholar and in situ and biochemical analyses reported herein that confirm expression in relevant brain regions and demonstrate the presence of CNTNAP2 in the synaptic plasma membrane fraction of rat forebrain lysates. We comprehensively resequenced CNTNAP2 in 635 patients and 942 controls. Among patients, we identified a total of 27 nonsynonymous changes; 13 were rare and unique to patients and 8 of these were predicted to be deleterious by bioinformatic approaches and/or altered residues conserved across all species. One variant at a highly conserved position, I869T, was inherited by four affected children in three unrelated families, but was not found in 4010 control chromosomes (p = 0.014). Overall, this resequencing data demonstrated a modest nonsignificant increase in the burden of rare variants in cases versus controls. Nonethless, when viewed in light of two independent studies published in this issue of AJHG showing a relationship between ASD and common CNTNAP2 alleles,4Alarcón M. Abrahams B.S. Stone J.L. Duvall J.A. Perederiy J.V. Bomar J.M. Sebat J. Wigler M. Martin C.L. Ledbetter D.H. et al.Linkage, association, and gene-expression analyses identify CNTNAP2 as an autism-susceptibility gene.Am. J. Hum. Genet. 2008; 82 (this issue): 150-159Abstract Full Text Full Text PDF PubMed Scopus (581) Google Scholar, 5Arking D.E. Cutler D.J. Brune C.W. Teslovich T.M. West K. Ikeda M. Rea A. Guy M. Lin S. Cook Jr., E.H. Chakravarti A. A common genetic variant in the neurexin superfamily member CNTNAP2 increases familial risk of autism.Am. J. Hum. Genet. 2008; 82 (this issue): 160-164Abstract Full Text Full Text PDF PubMed Scopus (434) Google Scholar the cytogenetic and mutation screening data suggest that rare variants may also contribute to the pathophysiology of ASD, but place limits on the magnitude of this contribution. Autism spectrum disorders (ASD) are a group of related neurodevelopmental syndromes with complex genetic etiology.1Gupta A.R. State M.W. Recent advances in the genetics of autism.Biol. Psychiatry. 2007; 61: 429-437Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar We identified a de novo chromosome 7q inversion disrupting Autism susceptibility candidate 2 (AUTS2) and Contactin Associated Protein-Like 2 (CNTNAP2) in a child with cognitive and social delay. We focused our initial analysis on CNTNAP2 based on our demonstration of disruption of Contactin 4 (CNTN4) in a patient with ASD;2Fernandez T. Morgan T. Davis N. Klin A. Morris A. Farhi A. Lifton R.P. State M.W. Disruption of contactin 4 (CNTN4) results in developmental delay and other features of 3p deletion syndrome.Am. J. Hum. Genet. 2004; 74: 1286-1293Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar the recent finding of rare homozygous mutations in CNTNAP2 leading to intractable seizures and autism;3Strauss K.A. Puffenberger E.G. Huentelman M.J. Gottlieb S. Dobrin S.E. Parod J.M. Stephan D.A. Morton D.H. Recessive symptomatic focal epilepsy and mutant contactin-associated protein-like 2.N. Engl. J. Med. 2006; 354: 1370-1377Crossref PubMed Scopus (454) Google Scholar and in situ and biochemical analyses reported herein that confirm expression in relevant brain regions and demonstrate the presence of CNTNAP2 in the synaptic plasma membrane fraction of rat forebrain lysates. We comprehensively resequenced CNTNAP2 in 635 patients and 942 controls. Among patients, we identified a total of 27 nonsynonymous changes; 13 were rare and unique to patients and 8 of these were predicted to be deleterious by bioinformatic approaches and/or altered residues conserved across all species. One variant at a highly conserved position, I869T, was inherited by four affected children in three unrelated families, but was not found in 4010 control chromosomes (p = 0.014). Overall, this resequencing data demonstrated a modest nonsignificant increase in the burden of rare variants in cases versus controls. Nonethless, when viewed in light of two independent studies published in this issue of AJHG showing a relationship between ASD and common CNTNAP2 alleles,4Alarcón M. Abrahams B.S. Stone J.L. Duvall J.A. Perederiy J.V. Bomar J.M. Sebat J. Wigler M. Martin C.L. Ledbetter D.H. et al.Linkage, association, and gene-expression analyses identify CNTNAP2 as an autism-susceptibility gene.Am. J. Hum. Genet. 2008; 82 (this issue): 150-159Abstract Full Text Full Text PDF PubMed Scopus (581) Google Scholar, 5Arking D.E. Cutler D.J. Brune C.W. Teslovich T.M. West K. Ikeda M. Rea A. Guy M. Lin S. Cook Jr., E.H. Chakravarti A. A common genetic variant in the neurexin superfamily member CNTNAP2 increases familial risk of autism.Am. J. Hum. Genet. 2008; 82 (this issue): 160-164Abstract Full Text Full Text PDF PubMed Scopus (434) Google Scholar the cytogenetic and mutation screening data suggest that rare variants may also contribute to the pathophysiology of ASD, but place limits on the magnitude of this contribution. The clinical hallmarks of ASD (MIM 209850) are derangements in reciprocal social interaction, abnormal development of speech and language, and the presence of highly restricted interests and stereotyped behaviors.6Tuchman R. Rapin I. Epilepsy in autism.Lancet Neurol. 2002; 1: 352-358Abstract Full Text Full Text PDF PubMed Scopus (498) Google Scholar Fundamental impairment in some but not all of these domains defines a spectrum of conditions that includes Asperger syndrome and Pervasive Developmental Disorder Not Otherwise Specified (PDD-NOS). In the DSM-IV, rare developmental disorders including Rett Syndrome and Childhood Disintegrative Disorder6Tuchman R. Rapin I. Epilepsy in autism.Lancet Neurol. 2002; 1: 352-358Abstract Full Text Full Text PDF PubMed Scopus (498) Google Scholar are grouped in the same diagnostic category. A majority of patients with ASD have MR in addition to their social disability and up to one-third suffer from seizures.6Tuchman R. Rapin I. Epilepsy in autism.Lancet Neurol. 2002; 1: 352-358Abstract Full Text Full Text PDF PubMed Scopus (498) Google Scholar Individuals with ASD also show an increased burden of chromosomal abnormalities1Gupta A.R. State M.W. Recent advances in the genetics of autism.Biol. Psychiatry. 2007; 61: 429-437Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar and de novo rare copy number variants.7Sebat J. Lakshmi B. Malhotra D. Troge J. Lese-Martin C. Walsh T. Yamrom B. Yoon S. Krasnitz A. Kendall J. et al.Strong association of de novo copy number mutations with autism.Science. 2007; 316: 445-449Crossref PubMed Scopus (1973) Google Scholar Despite multiple lines of evidence suggesting a complex genetic etiology, common ASD variants have been extremely difficult to identify.1Gupta A.R. State M.W. Recent advances in the genetics of autism.Biol. Psychiatry. 2007; 61: 429-437Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar In addition, to date there has not been a convergence between the rare mutations identified in nonsyndromic autism, such as those in the Neuroligin gene family,8Jamain S. Quach H. Betancur C. Rastam M. Colineaux C. Gillberg I.C. Soderstrom H. Giros B. Leboyer M. Gillberg C. et al.Mutations of the X-linked genes encoding neuroligins NLGN3 and NLGN4 are associated with autism.Nat. Genet. 2003; 34: 27-29Crossref PubMed Scopus (1277) Google Scholar, 9Laumonnier F. Bonnet-Brilhault F. Gomot M. Blanc R. David A. Moizard M.P. Raynaud M. Ronce N. Lemonnier E. Calvas P. et al.X-linked mental retardation and autism are associated with a mutation in the NLGN4 gene, a member of the neuroligin family.Am. J. Hum. Genet. 2004; 74: 552-557Abstract Full Text Full Text PDF PubMed Scopus (579) Google Scholar, 10Vincent J.B. Kolozsvari D. Roberts W.S. Bolton P.F. Gurling H.M. Scherer S.W. Mutation screening of X-chromosomal neuroligin genes: no mutations in 196 autism probands.Am. J. Med. Genet. B. Neuropsychiatr. Genet. 2004; 129: 82-84Crossref Scopus (93) Google Scholar, 11Gauthier J. Bonnel A. St-Onge J. Karemera L. Laurent S. Mottron L. Fombonne E. Joober R. Rouleau G.A. NLGN3/NLGN4 gene mutations are not responsible for autism in the Quebec population.Am. J. Med. Genet. B. Neuropsychiatr. Genet. 2005; 132: 74-75Crossref Scopus (96) Google Scholar, 12Ylisaukko-oja T. Rehnstrom K. Auranen M. Vanhala R. Alen R. Kempas E. Ellonen P. Turunen J.A. Makkonen I. Riikonen R. et al.Analysis of four neuroligin genes as candidates for autism.Eur. J. Hum. Genet. 2005; 13: 1285-1292Crossref PubMed Scopus (108) Google Scholar, 13Blasi F. Bacchelli E. Pesaresi G. Carone S. Bailey A.J. Maestrini E. Absence of coding mutations in the X-linked genes neuroligin 3 and neuroligin 4 in individuals with autism from the IMGSAC collection.Am. J. Med. Genet. B. Neuropsychiatr. Genet. 2006; 141: 220-221Crossref Scopus (72) Google Scholar and those genomic regions most strongly implicated by nonparametric linkage or common variant association studies. Difficulties in clarifying the genetic substrates of ASD likely reflect the combination of marked locus and allelic heterogeneity, the absence of reliable biological diagnostic markers, and the likelihood that any contributing common alleles will be found to carry quite small increments of risk, requiring very large sample sizes to definitively confirm their contributions.1Gupta A.R. State M.W. Recent advances in the genetics of autism.Biol. Psychiatry. 2007; 61: 429-437Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar Because of high rates of overlap between ASD, MR, and chromosomal abnormalities, we have used molecular cytogenetic mapping of balanced rearrangements in children with social and cognitive delays as a means of identifying candidate genes that may harbor rare disease alleles. We evaluated a patient with MR and a de novo inversion of chromosome 7 (46,XY,inv(7)(q11.22;q35)) (Appendix A). Based on the Autism Diagnostic Interview-Revised (ADI-R), the index case met “broad spectrum” criteria according to the Autism Genetics Research Exchange (AGRE) phenotype algorithm (Appendix A) but did not meet the full criteria for ASD according to the combination of ADI-R and Autism Diagnostic Observations Scales (ADOS). We mapped the chromosomal rearrangement by using fluorescent in situ hybridization as described14Dracopoli N.C. Haines J.L. Korf B.R. Morton C.C. Seidman C.E. Seidman J.G. Smith De R. Current Protocols in Human Genetics. John Wiley & Sons, Hoboken, NJ2005Google Scholar and found that the inversion breakpoints disrupted the genes AUTS2 at 7q11.22 and CNTNAP2 at 7q35 (Figure 1). AUTS2 maps to a 1.2 MB genomic region of 7q11.22; BAC RP11-709J20 spans the inversion and is within intron 5, placing the break between exons 5 and 6. CNTNAP2 maps to a 2.3 MB genomic region on 7q35; BAC RP11-1012D24 was found to span the inversion and includes coding exons 11 and 12, placing the break between exons 10 and 13. We further evaluated the patient by performing array-based competitive genomic hybridization with a chromosome 7-specific microarray containing approximately 385,000 probes with an average spacing of 400 base pairs (Nimblegen). No large-scale deletions or duplication were observed within several megabases of the breakpoints. Both genes, either alone or in combination, represent strong candidates for contributing to the etiology of the cognitive and social delays seen in the index case. AUTS2 encodes a predicted protein of unknown function that was originally identified through mapping of a chromosomal abnormality in a pair of twins with ASD.15Sultana R. Yu C.E. Yu J. Munson J. Chen D. Hua W. Estes A. Cortes F. de la Barra F. Yu D. et al.Identification of a novel gene on chromosome 7q11.2 interrupted by a translocation breakpoint in a pair of autistic twins.Genomics. 2002; 80: 129-134Crossref PubMed Scopus (129) Google Scholar Additionally, three cases of MR and balanced translocations of AUTS2 have been reported recently.16Kalscheuer V.M. FitzPatrick D. Tommerup N. Bugge M. Niebuhr E. Neumann L.M. Tzschach A. Shoichet S.A. Menzel C. Erdogan F. et al.Mutations in autism susceptibility candidate 2 (AUTS2) in patients with mental retardation.Hum. Genet. 2007; 121: 501-509Crossref PubMed Scopus (93) Google Scholar However, a copy number polymorphism in unaffected individuals has also been reported at the AUTS2 locus,17Redon R. Ishikawa S. Fitch K.R. Feuk L. Perry G.H. Andrews T.D. Fiegler H. Shapero M.H. Carson A.R. Chen W. et al.Global variation in copy number in the human genome.Nature. 2006; 444: 444-454Crossref PubMed Scopus (3067) Google Scholar suggesting that haploinsufficiency and structural rearrangements at this interval may be tolerated in some cases. We evaluated the expression of AUTS2 mRNA by RT-PCR in peripheral lymphoblasts from the patient as well as unaffected family members; the patient's expression levels were normal for exons 5′ to the break, but reduced by approximately 50% for exons distal to it (data not shown). Results of resequencing of this gene will be described in a separate paper. CNTNAP2 is also a strong candidate for involvement in social and cognitive delay. It is a neuronal cell adhesion molecule known to interact with Contactin 2 (Cntn2), also known as TAG-1, at the juxtaparanodal region at the nodes of Ranvier, which are the regularly spaced gaps between the myelin-producing Schwann cells in the peripheral nervous system (PNS).18Traka M. Goutebroze L. Denisenko N. Bessa M. Nifli A. Havaki S. Iwakura Y. Fukamauchi F. Watanabe K. Soliven B. et al.Association of TAG-1 with Caspr2 is essential for the molecular organization of juxtaparanodal regions of myelinated fibers.J. Cell Biol. 2003; 162: 1161-1172Crossref PubMed Scopus (180) Google Scholar, 19Poliak S. Salomon D. Elhanany H. Sabanay H. Kiernan B. Pevny L. Stewart C.L. Xu X. Chiu S.Y. Shrager P. et al.Juxtaparanodal clustering of Shaker-like K+ channels in myelinated axons depends on Caspr2 and TAG-1.J. Cell Biol. 2003; 162: 1149-1160Crossref PubMed Scopus (375) Google Scholar Whereas previous investigations have largely focused on the role of CNTNAP2 in PNS development, a recent report demonstrated that a homozygous CNTNAP2 mutation in the Old Order Amish population results in intractable seizures, histologically confirmed cortical neuronal migration abnormalities, MR, and ASD.3Strauss K.A. Puffenberger E.G. Huentelman M.J. Gottlieb S. Dobrin S.E. Parod J.M. Stephan D.A. Morton D.H. Recessive symptomatic focal epilepsy and mutant contactin-associated protein-like 2.N. Engl. J. Med. 2006; 354: 1370-1377Crossref PubMed Scopus (454) Google Scholar These data, along with our earlier identification of a cytogenetic disruption of CNTN4 in a child with MR and ASD,2Fernandez T. Morgan T. Davis N. Klin A. Morris A. Farhi A. Lifton R.P. State M.W. Disruption of contactin 4 (CNTN4) results in developmental delay and other features of 3p deletion syndrome.Am. J. Hum. Genet. 2004; 74: 1286-1293Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar suggests the possible involvement of a Contactin-related pathway in these disorders. As was the case with AUTS2, evidence from available reports of cytogenetic abnormalities involving CNTNAP2 has been inconsistent. In one instance, Tourette syndrome and developmental delay were identified in a family carrying a complex rearrangement disrupting CNTNAP2.20Verkerk A.J. Mathews C.A. Joosse M. Eussen B.H. Heutink P. Oostra B.A. CNTNAP2 is disrupted in a family with Gilles de la Tourette syndrome and obsessive compulsive disorder.Genomics. 2003; 82: 1-9Crossref PubMed Scopus (186) Google Scholar More recently, carriers of a balanced t(7;15) translocation involving the coding region of CNTNAP2 were described as normal.21Belloso J.M. Bache I. Guitart M. Caballin M.R. Halgren C. Kirchhoff M. Ropers H.H. Tommerup N. Tumer Z. Disruption of the CNTNAP2 gene in a t(7;15) translocation family without symptoms of Gilles de la Tourette syndrome.Eur. J. Hum. Genet. 2007; 15: 711-713Crossref PubMed Scopus (63) Google Scholar Given the absence of expression of CNTNAP2 in peripheral lymphoblasts, we were not able to directly evaluate expression changes in our index case. However, our characterization of the de novo inversion in the only affected member of the pedigree, our previous findings with regard to CNTN4,2Fernandez T. Morgan T. Davis N. Klin A. Morris A. Farhi A. Lifton R.P. State M.W. Disruption of contactin 4 (CNTN4) results in developmental delay and other features of 3p deletion syndrome.Am. J. Hum. Genet. 2004; 74: 1286-1293Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar and the strong evidence that rare homozygous mutations in CNTNAP2 cause ASD3Strauss K.A. Puffenberger E.G. Huentelman M.J. Gottlieb S. Dobrin S.E. Parod J.M. Stephan D.A. Morton D.H. Recessive symptomatic focal epilepsy and mutant contactin-associated protein-like 2.N. Engl. J. Med. 2006; 354: 1370-1377Crossref PubMed Scopus (454) Google Scholar supported the hypothesis that this molecule plays a key role in central nervous system (CNS) development, and autism in particular, and led us to study the transcript and its protein product. We examined the distribution of Cntnap2 mRNA in the mouse and human CNS by using in situ hybridization22Grove E.A. Tole S. Limon J. Yip L. Ragsdale C.W. The hem of the embryonic cerebral cortex is defined by the expression of multiple Wnt genes and is compromised in Gli3-deficient mice.Development. 1998; 125: 2315-2325Crossref PubMed Google Scholar with digoxigenin-11-UTP RNA probes complementary to bases 3909 to 4890 of the mouse Cntnap2 cDNA (NM_025771) or to bases 1343 to 2496 of the human CNTNAP2 cDNA (NM_014141.3). We found widespread expression in embryonic and postnatal mouse brain including within the limbic system ( Figures 2 and 3C), a neuroanatomical circuit implicated in social behavior. In human brain, we confirmed previous findings of CNTNAP2 mRNA in all cortical layers of the temporal lobe (Figure 3).Figure 3Expression and Biochemical Analyses of CNTNAP2/Cntnap2Show full caption(A–C) Cortical expression of CNTNAP2/Cntnap2. Sections of human temporal cortex at 6 and 58 years of age (A and B) and P7 mouse cortex (C) were hybridized with corresponding antisense riboprobes. Expression is detected in cortical layers II–V in the human temporal lobe (A and B) and II–VI in the mouse neocortex (C).(D) Cofractionation of Cntn2/TAG-1 and Cntnap2 in synaptic plasma membranes. Rat forebrain homogenate (homog.) was subfractionated into postnuclear supernatant (S1), synaptosomal supernatant (S2), crude synaptosomes (P2), synaptosomal membranes (LP1), crude synaptic vesicles (LP2), synaptic plasma membranes (SPM), and mitochondria (mito.). The synaptic membrane protein N-cadherin and the synaptic vesicle protein synaptotagmin 1 served as markers for these respective fractions. Numbers on the left indicate positions of molecular weight markers. Protein concentrations were determined with the Pierce BCA assay and equal amounts of each fraction were analyzed. Monoclonal antibodies to Cntn2/TAG-1 (3.1C12, developed by Thomas Jessell, Columbia University) were obtained from the Developmental Studies Hybridoma Bank maintained by the University of Iowa, to synaptotagmin 1 (41.1) from Synaptic Systems (Göttingen, Germany), and to N-cadherin from BD Biosciences (# 610920). Polyclonal antibodies to Cntnap2 were obtained from Sigma (# C 8737).View Large Image Figure ViewerDownload Hi-res image Download (PPT) (A–C) Cortical expression of CNTNAP2/Cntnap2. Sections of human temporal cortex at 6 and 58 years of age (A and B) and P7 mouse cortex (C) were hybridized with corresponding antisense riboprobes. Expression is detected in cortical layers II–V in the human temporal lobe (A and B) and II–VI in the mouse neocortex (C). (D) Cofractionation of Cntn2/TAG-1 and Cntnap2 in synaptic plasma membranes. Rat forebrain homogenate (homog.) was subfractionated into postnuclear supernatant (S1), synaptosomal supernatant (S2), crude synaptosomes (P2), synaptosomal membranes (LP1), crude synaptic vesicles (LP2), synaptic plasma membranes (SPM), and mitochondria (mito.). The synaptic membrane protein N-cadherin and the synaptic vesicle protein synaptotagmin 1 served as markers for these respective fractions. Numbers on the left indicate positions of molecular weight markers. Protein concentrations were determined with the Pierce BCA assay and equal amounts of each fraction were analyzed. Monoclonal antibodies to Cntn2/TAG-1 (3.1C12, developed by Thomas Jessell, Columbia University) were obtained from the Developmental Studies Hybridoma Bank maintained by the University of Iowa, to synaptotagmin 1 (41.1) from Synaptic Systems (Göttingen, Germany), and to N-cadherin from BD Biosciences (# 610920). Polyclonal antibodies to Cntnap2 were obtained from Sigma (# C 8737). We also evaluated Cntnap2 protein and its putative binding partner, Cntn2/TAG-1, in subfractioned postnatal day 9 rat forebrain lysates.23Jones D.H. Matus A.I. Isolation of synaptic plasma membrane from brain by combined flotation-sedimentation density gradient centrifugation.Biochim. Biophys. Acta. 1974; 356: 276-287Crossref PubMed Scopus (546) Google Scholar, 24Biederer T. Sara Y. Mozhayeva M. Atasoy D. Liu X. Kavalali E.T. Sudhof T.C. SynCAM, a synaptic adhesion molecule that drives synapse assembly.Science. 2002; 297: 1525-1531Crossref PubMed Scopus (604) Google Scholar Both Cntnap2 and Cntn2/TAG-1 were present in the fraction containing synaptic plasma membranes, consistent with their forming a physical complex in this compartment (Figure 3D). These data localized CNTNAP2 and elements of a Contactin-related pathway with neuronal structures of marked interest with regard to autism,8Jamain S. Quach H. Betancur C. Rastam M. Colineaux C. Gillberg I.C. Soderstrom H. Giros B. Leboyer M. Gillberg C. et al.Mutations of the X-linked genes encoding neuroligins NLGN3 and NLGN4 are associated with autism.Nat. Genet. 2003; 34: 27-29Crossref PubMed Scopus (1277) Google Scholar, 9Laumonnier F. Bonnet-Brilhault F. Gomot M. Blanc R. David A. Moizard M.P. Raynaud M. Ronce N. Lemonnier E. Calvas P. et al.X-linked mental retardation and autism are associated with a mutation in the NLGN4 gene, a member of the neuroligin family.Am. J. Hum. Genet. 2004; 74: 552-557Abstract Full Text Full Text PDF PubMed Scopus (579) Google Scholar, 25Zoghbi H.Y. Postnatal neurodevelopmental disorders: meeting at the synapse?.Science. 2003; 302: 826-830Crossref PubMed Scopus (521) Google Scholar, 26Talebizadeh Z. Bittel D.C. Veatch O.J. Butler M.G. Takahashi T.N. Miles J.H. Do known mutations in neuroligin genes (NLGN3 and NLGN4) cause autism?.J. Autism Dev. Disord. 2004; 34: 735-736Crossref PubMed Scopus (33) Google Scholar, 27Craig A.M. Kang Y. Neurexin-neuroligin signaling in synapse development.Curr. Opin. Neurobiol. 2007; 17: 43-52Crossref PubMed Scopus (406) Google Scholar, 28Durand C.M. Betancur C. Boeckers T.M. Bockmann J. Chaste P. Fauchereau F. Nygren G. Rastam M. Gillberg I.C. Anckarsater H. et al.Mutations in the gene encoding the synaptic scaffolding protein SHANK3 are associated with autism spectrum disorders.Nat. Genet. 2007; 39: 25-27Crossref PubMed Scopus (1041) Google Scholar, 29Szatmari P. Paterson A.D. Zwaigenbaum L. Roberts W. Brian J. Liu X.Q. Vincent J.B. Skaug J.L. Thompson A.P. Senman L. et al.Mapping autism risk loci using genetic linkage and chromosomal rearrangements.Nat. Genet. 2007; 39: 319-328Crossref PubMed Scopus (1065) Google Scholar and prompted us to pursue an intensive genetic investigation of CNTNAP2 among individuals with ASD. All experiments were approved by the Yale University School of Medicine Institutional Animal Care and Use Committee. Given our cytogenetic data and the recent findings of Strauss et al.,3Strauss K.A. Puffenberger E.G. Huentelman M.J. Gottlieb S. Dobrin S.E. Parod J.M. Stephan D.A. Morton D.H. Recessive symptomatic focal epilepsy and mutant contactin-associated protein-like 2.N. Engl. J. Med. 2006; 354: 1370-1377Crossref PubMed Scopus (454) Google Scholar we elected to resequence all 24 coding exons of CNTNAP2 (Table 1) in 635 affected individuals and 942 uncharacterized controls. This approach was selected because it is robust in the face of allelic heterogeneity and has proven valuable in identifying rare causal mutations in idiopathic autism.8Jamain S. Quach H. Betancur C. Rastam M. Colineaux C. Gillberg I.C. Soderstrom H. Giros B. Leboyer M. Gillberg C. et al.Mutations of the X-linked genes encoding neuroligins NLGN3 and NLGN4 are associated with autism.Nat. Genet. 2003; 34: 27-29Crossref PubMed Scopus (1277) Google Scholar, 9Laumonnier F. Bonnet-Brilhault F. Gomot M. Blanc R. David A. Moizard M.P. Raynaud M. Ronce N. Lemonnier E. Calvas P. et al.X-linked mental retardation and autism are associated with a mutation in the NLGN4 gene, a member of the neuroligin family.Am. J. Hum. Genet. 2004; 74: 552-557Abstract Full Text Full Text PDF PubMed Scopus (579) Google Scholar Moreover, in other complex genetic disorders, heterozygote nonsynonymous variants found in genes contributing to rare recessive diseases have been shown to confer risks in the broader population.30Cohen J.C. Kiss R.S. Pertsemlidis A. Marcel Y.L. McPherson R. Hobbs H.H. Multiple rare alleles contribute to low plasma levels of HDL cholesterol.Science. 2004; 305: 869-872Crossref PubMed Scopus (874) Google ScholarTable 1Primer Sequences for Mutation Screening of CNTNAP2Exon NumberaAs defined by NM_014141.Forward PrimerReverse PrimerProduct Size (bp)1CACACAGTGCAAGAGGCAATACGATGCACTTCGGAGTTGATACC4202TTAACCAACACATACCAATCGTTGATTTCTGGTGTCTGCCAACAT2983GAAATAGAGCACTGCCAAGACCCATTGGATAGAAATTACAGCCTGA4814ACCATTGGATGACATTTGTGTTGGTAGTTTATTGTCAGAGAAAGCAA3555CATTTATTCTTTGCAGACACCTGTTTAAAGAATTGAGCAACATGAACA3686TATCCCAGGTTAACTCGAATGGTCAGGTTTTTAAAATTGTCAGTGTC4667ATTTTGGAGGCAGAATGCTATAATTTTGCCCAAACACAAATATGAT4008AGGCTGTGCTTCAAAACTTGTAGTAACACCAGCAAAACCAAACA4589AAATCGTGATTTGTTGATTTTGGTTTTTGTTTTGCTCAGTGGAATTA38210GTAGTTGGATGTGATGGCTGTGTGGTAATTTCCACCTTACCTGTTT39911ATATATTGCCCAGACAGCTTGGTTGGTTTTTCAGATTCGAGTGA31812GGTTTGCTAGCATTGCAATATGGAAACAAACCATTGGTGGAACT29213AACACTGTTCTACACCAGCTCAGTCTTAGCTTCATTCCCCAGAAA49614TCAGAGTATTCCTGGGGAAGTGTTTGTCAGTTGGGTTAGTTCCA39115TGCTATGAGACCACCTATGGAAAGTCTGATTGCAGGCATCTTCT39016GAGGATTTGGTCCAATGTTGTTGGCTTGTGTGTCCACCTCTAGT46517ATTTTGCCATCGACCTTTGTAGTGTGCAGGCTCTTAAAAATCAAC46818CTATGCAGTGTCATCTCCTACCACTTGGAAAATTCCTACCTAAGTTGA48819ACTTACTCAGATGCCCTTCCTGTGGCAAGTTGTTTTCCTGATATT53920GACATCAAGGGAGGGAGTAAAGCTATCCCCTCAAAACAAAACCA66721GGTGTTTTAGAGTCAGTGCTGATGAGAACAACCACGTAACTTTCCTGT38122TGCAGCCCTAAATCTTATCGACCCTGAGAACTCCGTACTCACAA56023CTGTTGTGATTCTTGTGGGAGACAGCAAAATGAATAATGTAAAAACC36724CTGACGGAGCTGTAGTGAAGTGCACGGGTCTTTAGAACACCTCTA611a As defined by NM_014141. Open table in a new tab DNA was amplified with a standard polymerase chain reaction (PCR) over 35 cycles with a 56.7°C annealing temperature31Abelson J.F. Kwan K.Y. O'Roak B.J. Baek D.Y. Stillman A.A. Morgan T.M. Mathews C.A. Pauls D.L. Rasin M.-R. Gunel M. et al.Sequence variants in SLITRK1 are associated with Tourette's Syndrome.Science. 2005; 310: 317-320Crossref PubMed Scopus (728) Google Scholar and analyzed with Sequencher (Genecodes) or PolyPhred software after dye terminating sequencing on one strand. Use of human subjects was approved and performed in accordance with the Yale University School of Medicine Human Investigation Committee. The Institutional Review Board at the University of Pennsylvania School of Medicine provides human subjects protection and oversight for AGRE. We evaluated both cases and controls in the identical fashion in search of rare nonsynonymous, frame-shift, nonsense, and splice-site variants. Those changes that were found only in the case or the control group in the initial sequencing effort were further genotyped with Custom Taqman Genotyping assays (Applied Biosystems) in an additional control sample of 1073 unrelated white subjects. Variants with allele frequencies greater than 1/4000 in the combined control sample were excluded (data available on request). One variant, R283C, which was found once among the sequenced controls, failed further genotyping but was included in subsequent analyses. All rare nonsynonymous variants were examined for conservation across diverse species with a ClustalW alignment to the top full-length BLASTp hits of each species (Table 2; see Figure S1
