Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (PLOSL), also known as "Nasu-Hakola disease," is a globally distributed recessively inherited disease leading to death during the 5th decade of life and is characterized by early-onset progressive dementia and bone cysts. Elsewhere, we have identified PLOSL mutations in TYROBP (DAP12), which codes for a membrane receptor component in natural-killer and myeloid cells, and also have identified genetic heterogeneity in PLOSL, with some patients carrying no mutations in TYROBP. Here we complete the molecular pathology of PLOSL by identifying TREM2 as the second PLOSL gene. TREM2 forms a receptor signaling complex with TYROBP and triggers activation of the immune responses in macrophages and dendritic cells. Patients with PLOSL have no defects in cell-mediated immunity, suggesting a remarkable capacity of the human immune system to compensate for the inactive TYROBP-mediated activation pathway. Our data imply that the TYROBP-mediated signaling pathway plays a significant role in human brain and bone tissue and provide an interesting example of how mutations in two different subunits of a multisubunit receptor complex result in an identical human disease phenotype. Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (PLOSL), also known as "Nasu-Hakola disease," is a globally distributed recessively inherited disease leading to death during the 5th decade of life and is characterized by early-onset progressive dementia and bone cysts. Elsewhere, we have identified PLOSL mutations in TYROBP (DAP12), which codes for a membrane receptor component in natural-killer and myeloid cells, and also have identified genetic heterogeneity in PLOSL, with some patients carrying no mutations in TYROBP. Here we complete the molecular pathology of PLOSL by identifying TREM2 as the second PLOSL gene. TREM2 forms a receptor signaling complex with TYROBP and triggers activation of the immune responses in macrophages and dendritic cells. Patients with PLOSL have no defects in cell-mediated immunity, suggesting a remarkable capacity of the human immune system to compensate for the inactive TYROBP-mediated activation pathway. Our data imply that the TYROBP-mediated signaling pathway plays a significant role in human brain and bone tissue and provide an interesting example of how mutations in two different subunits of a multisubunit receptor complex result in an identical human disease phenotype. Since TYROBP encodes a cell-surface receptor element that interacts with many different proteins depending on the cell type, we used a genetic approach to search for genes involved in polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (PLOSL [MIM 221770]), also known as "Nasu-Hakola disease" (Nasu et al. Nasu et al., 1973Nasu T Tsukahara Y Terayama K A lipid metabolic disease—"membranous lipodystrophy"—an autopsy case demonstrating numerous peculiar membrane-structures composed of compound lipid in bone and bone marrow and various adipose tissues.Acta Pathol Jpn. 1973; 23: 539-558PubMed Google Scholar; Paloneva et al. Paloneva et al., 2001Paloneva J Autti T Raininko R Partanen J Salonen O Puranen M Hakola P Haltia M CNS manifestations of Nasu-Hakola disease: a frontal dementia with bone cysts.Neurology. 2001; 56: 1552-1558Crossref PubMed Google Scholar; also see the GeneTests–GeneClinics Web site). We initially analyzed two informative families showing exclusion of linkage to the PLOSL locus located on chromosome 19q13.1 (Pekkarinen et al. Pekkarinen et al., 1998aPekkarinen P Hovatta I Hakola P Jarvi O Kestila M Lenkkeri U Adolfsson R Holmgren G Nylander PO Tranebjærg L Terwilliger JD Lonnqvist J Peltonen L Assignment of the locus for PLO-SL, a frontal-lobe dementia with bone cysts, to 19q13.Am J Hum Genet. 1998a; 62: 362-372Abstract Full Text Full Text PDF PubMed Scopus (39) Google ScholarPekkarinen et al., 1998bPekkarinen P Kestila M Paloneva J Terwilliger J Varilo T Jarvi O Hakola P Peltonen L Fine-scale mapping of a novel dementia gene, PLOSL, by linkage disequilibrium.Genomics. 1998b; 54: 307-315Crossref PubMed Scopus (19) Google Scholar), for segregation of the marker haplotypes flanking genes that encode the polypeptides interacting with TYROBP. These genes included those for TYROBP-associated receptors SIRPBETA1 (chromosome 20p13) (Dietrich et al. Dietrich et al., 2000Dietrich J Cella M Seiffert M Bühring HJ Colonna M Signal-regulatory protein 1 is a DAP12-associated activating receptor expressed in myeloid cells.J Immunol. 2000; 164: 9-12PubMed Google Scholar), TREM1 (chromosome 6p21.2), TREM2 (chromosome 6p21.2) (Bouchon et al. Bouchon et al., 2000Bouchon A Dietrich J Colonna M Cutting edge: inflammatory responses can be triggered by TREM-1, a novel receptor expressed on neutrophils and monocytes.J Immunol. 2000; 164: 4991-4995PubMed Google Scholar), LY95 (NKp44, chromosome 6p22.1) (Vitale et al. Vitale et al., 1998Vitale M Bottino C Sivori S Sanseverino L Castriconi R Marcenaro E Augugliaro R Moretta L Moretta A NKp44, a novel triggering surface molecule specifically expressed by activated natural killer cells, is involved in non-major histocompatibility complex-restricted tumor cell lysis.J Exp Med. 1998; 187: 2065-2072Crossref PubMed Scopus (567) Google Scholar), MDL1 (chromosome 7q33) (Bakker et al. Bakker et al., 1999Bakker ABH Baker E Sutherland GR Phillips JH Lanier LL Myeloid DAP12-associating lectin (MDL)-1 is a cell surface receptor involved in the activation of myeloid cells.Proc Natl Acad Sci USA. 1999; 96: 9792-9796Crossref PubMed Scopus (168) Google Scholar), CD94 (chromosome 12p13.3) (Lanier et al. Lanier et al., 1998bLanier LL Corliss B Wu J Phillips JH Association of DAP12 with activating CD94/NKG2C NK cell receptors.Immunity. 1998b; 8: 693-701Abstract Full Text Full Text PDF PubMed Scopus (403) Google Scholar), KIR2DS2 (chromosome 19q13.4) (Lanier et al. Lanier et al., 1998aLanier LL Corliss BC Wu J Leong C Phillips JH Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells.Nature. 1998a; 391: 703-707Crossref PubMed Scopus (705) Google Scholar), and NKG2C (chromosome 12p13.1) (Lanier et al. Lanier et al., 1998bLanier LL Corliss B Wu J Phillips JH Association of DAP12 with activating CD94/NKG2C NK cell receptors.Immunity. 1998b; 8: 693-701Abstract Full Text Full Text PDF PubMed Scopus (403) Google Scholar). Furthermore, haplotypes of chromosomal regions containing genes for the intracellular protein tyrosine kinases (PTKs) SYK (chromosome 9q22.1) and ZAP70 (chromosome 2q11.2) (Lanier et al. Lanier et al., 1998aLanier LL Corliss BC Wu J Leong C Phillips JH Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells.Nature. 1998a; 391: 703-707Crossref PubMed Scopus (705) Google Scholar McVicar et al. McVicar et al., 1998McVicar DW Taylor LS Gosselin P Willette-Brown J Mikhael AI Geahlen RL Nakamura MC Linnemeyer P Seaman WE Anderson SK Ortaldo JR Mason LH DAP12-mediated signal transduction in natural killer cells: a dominant role for the Syk protein-tyrosine kinase.J Biol Chem. 1998; 273: 32934-32942Crossref PubMed Scopus (182) Google Scholar) of the downstream signal-transduction pathway were analyzed for cosegregation. For haplotype construction, we selected two or three polymorphic markers flanking each candidate gene. We genotyped the following polymorphic markers: D6S1616, D6S1575, and D6S1549, for TREM1, TREM2, and LY95; D20S198 and D20S906, for SIRBETA1; D7S661 and D7S2513, for MDL1; D12S336, for CD94; D19S926 and D19S891, for KIR2DS; D12S77 and D12S1697, for NKG2C; D9S1836 and D9S1820, for SYK and D2S2222; and D2S2175, for ZAP70. The position of the genes and markers were determined by Ensembl, version 3.26.1 (see the Emsembl Human Web site), and the UCSC Human Genome Browser (August 6, 2001, draft assembly [see the UCSC Human Genome Project Working Draft Web site]). Information on the sequence of the primers is available at the UCSC Human Genome Browser (see the UCSC Human Genome Project Working Draft Web site). Genotyping was performed as described elsewhere (Wessman et al. Wessman et al., 2002Wessman M Kallela M Kaunisto MA Marttila P Sobel E Hartiala J Oswell G Leal SM Papp JC Hamalainen E Broas P Joslyn G Hovatta I Hiekkalinna T Kaprio J Ott J Cantor RM Zwart JA Ilmavirta M Havanka H Farkkila M Peltonen L Palotie A A susceptibility locus for migraine with aura, on chromosome 4q24.Am J Hum Genet. 2002; 70: 652-662Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). The genotyped families originated from Sweden (Nylander et al. Nylander et al., 1996Nylander PO Drugge U Holmgren G Adolfsson R Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (PLO-SL): a geneological study of Swedish families of probable Finnish background.Clin Genet. 1996; 50: 353-357Crossref PubMed Scopus (8) Google Scholar) and Norway (Edvardsen et al. Edvardsen et al., 1983Edvardsen P Halvorsen TB Nesse O Lipomembranous osteodysplasia: a case report.Int Orthop. 1983; 7: 99-103Crossref PubMed Scopus (16) Google Scholar), and each had two affected family members (Pekkarinen et al. Pekkarinen et al., 1998aPekkarinen P Hovatta I Hakola P Jarvi O Kestila M Lenkkeri U Adolfsson R Holmgren G Nylander PO Tranebjærg L Terwilliger JD Lonnqvist J Peltonen L Assignment of the locus for PLO-SL, a frontal-lobe dementia with bone cysts, to 19q13.Am J Hum Genet. 1998a; 62: 362-372Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar Paloneva et al. Paloneva et al., 2000Paloneva J Kestila M Wu J Salminen A Bohling T Ruotsalainen V Hakola P Bakker AB Phillips JH Pekkarinen P Lanier LL Timonen T Peltonen L Loss-of-function mutations in TYROBP (DAP12) result in a presenile dementia with bone cysts.Nat Genet. 2000; 25: 357-361Crossref PubMed Scopus (337) Google Scholar). The only chromosomal region showing complete cosegregation with PLOSL was the 6p21-p22 region covered by the markers D6S1616, D6S1575, and D6S1549 (fig. 1). This 10-cM DNA region contains genes for TREM1, TREM2, and LY95. The patients in the Swedish and Norwegian families were homozygous for different haplotypes, implying two independent mutations. Sequence analysis of the genomic DNA of the patients revealed mutations only in TREM2 (for primer sequences, see table 1). The Swedish family had a homozygous G-to-A mutation at position 233 (233G→A), changing tryptophan 78 to a translation termination codon (W78X). This same mutation also was found in another Swedish family, which had three affected family members, but DNA for sequencing was available from only one patient. In the Norwegian family, a 558G→A mutation was found, resulting in conversion of lysine 186 to asparagine (K186N) (fig. 2). Neither of these mutations was found in a control panel of 100 Scandinavian DNA samples.Table 1Genomic and cDNA Primer Sequences Used to Amplify TYROBP, TREM1, TREM2, and ACTBPrimeraExcept in the cases of exons 4 and 5 of TREM2 that were sequenced by primers with the designation ending with "seq," PCR primers were used for sequencing. (5′→3′)FragmentForwardReverseTYROBP: Exon 1tggggacggaggtgaagtttcccatcccaacacccacttt Exon 2gcctgtgggtttctcccagaggcagggaggtttggaaagg Exon 3ccgtctctcccacaccctttcctccattaccatccctttgga Exon 4gggctgggtaaactcccagacccagcccctcttcacacat Exon 5gcagaggagaagggggaacaagtattggggagcggtctgg Intron 1gtggtgagttaggggcttcctctgcacaacttgtcctgtgg TYROBP by quantitative RT-PCRatggggggacttgaaccctcatttgtaatacggcctctgtgTREM1: Exon 1acttaactgagaagtgagtcttggtctcgcagtagtatatttgctgtcccatagtag Exon 2atatgggtggttggacaagaaaagacagactgctgggaatcct Exon 3ctcatccacattttcatccatacatcgacatttctacccagactaatgtgact Exon 4gcaaggatctaagcagaggagatgtttggggctgtaacttctttTREM2: Exon 1caccgccttcataattcaccgactcctcctcccctctgtc Exon 2agtgggtggttctgcacactccttcagggcaggattttt Exon 3gctctagttgccttgtaatttgtagttagtgtaatgacctgatccacataggac Exons 4 and 5agcaaaatctcttgtctttttctcatccctagaactcaagtctcttgactatgg Exon 4 seqtcttccttcacgtgtctctcagcccattccctgagagaagatt Exon 5 seqcctcaaggagcaaaatctcttgtccagggtatcagctccaaac TREM2 probeatggagcctctccggctgcttcacgtgtctctcagccctg TREM2 by quantitative RT-PCRatggagcctctccggctgcttcacgtgtctctcagccctgACTB: ACTB by quantitative RT-PCRtcacccacactgtgcccatctacgacagcggaaccgctcattgccaatgga Except in the cases of exons 4 and 5 of TREM2 that were sequenced by primers with the designation ending with "seq," PCR primers were used for sequencing. Open table in a new tab Figure 2Schematic presentation of the identified PLOSL mutations in TREM2. The positions of other loci for TYROBP-associated cell-surface receptors, TREM1 and LY95, as well as of the polymorphic "D" markers used in the segregation analysis, are indicated.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Since our sequence analyses of TYROBP from one American (whose family originates from Slovakia [Bird et al. Bird et al., 1983Bird TD Koerker RM Leaird BJ Vlcek BW Thorning DR Lipomembranous polycystic osteodysplasia (brain, bone, and fat disease): a genetic cause of presenile dementia.Neurology. 1983; 33: 81-86Crossref PubMed Google Scholar]), from one Bolivian, and from two Italian sibs, all of whom have PLOSL, had not revealed mutations, we amplified and sequenced the exons and intron-exon boundaries of TREM2 from the genomic DNA of these patients. All had mutations in TREM2: the American patient was homozygous for a 401A→G substitution, resulting in conversion of the aspartic acid residue to glycine, at position 134 (D134G). The two Italian patients were homozygous for a conversion of nucleotide T to nucleotide C, in the splice-donor consensus site at the second position of intron 3 (482+2T→C), whereas their two unaffected sibs were homozygous for the normal allele. In the Bolivian patient, a homozygous 132G→A mutation changed tryptophan at position 44 to a translation stop codon (W44X). None of the mutations was observed in a control panel of 100 white individuals. The positions of the identified TREM2 mutations are shown in figure 2. The 230-amino-acid TREM2 polypeptide belongs to the immunoglobulin superfamily (Ig-SF) and is predicted to consist of a 13-amino-acid signal peptide followed by a 154-amino-acid extracellular domain encoded by exons 2 and 3, with two cysteines potentially involved in generating an intrachain disulfide bridge of the Ig-SF V–type fold. The 33-amino-acid transmembrane domain is followed by a short, 30-amino-acid long cytoplasmic domain (Bouchon et al. Bouchon et al., 2000Bouchon A Dietrich J Colonna M Cutting edge: inflammatory responses can be triggered by TREM-1, a novel receptor expressed on neutrophils and monocytes.J Immunol. 2000; 164: 4991-4995PubMed Google Scholar). On the cell membrane of macrophages and dendritic cells, TREM2 is bound noncovalently to a disulfide-bonded TYROBP homodimer (Campbell and Colonna Campbell and Colonna, 1999Campbell KS Colonna M. DAP12: a key accessory protein for relaying signals by natural killer cell receptors.Int J Biochem Cell Biol. 1999; 31: 631-636Crossref PubMed Scopus (40) Google Scholar; Bouchon et al. Bouchon et al., 2001bBouchon A Hernandez-Munain C Cella M Colonna M A dap12-mediated pathway regulates expression of cc chemokine receptor 7 and maturation of human dendritic cells.J Exp Med. 2001b; 194: 1111-1122Crossref PubMed Scopus (322) Google Scholar). This interaction is mediated by oppositely charged amino acids in the transmembrane domains of these proteins; one of these amino acids is a positively charged lysine in TREM2, and the other is a negatively charged aspartic acid in TYROBP. The interaction between TREM2 and an unidentified ligand results in the phosphorylation of tyrosines in the intracellular tyrosine-based activation motif (ITAM) of TYROBP. Phosphorylated ITAM binds the cytosolic PTKs SYK and ZAP70, and this interaction leads to an increase in intracellular Ca2+ concentration and to subsequent cellular activation (Lanier and Bakker Lanier and Bakker, 2000Lanier LL Bakker AB The ITAM-bearing transmembrane adaptor DAP12 in lymphoid and myeloid cell function.Immunol Today. 2000; 21: 611-614Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar). The mutations in the Bolivian (W44X) and Swedish (W78X) patients are predicted to result in the generation of a truncated protein lacking the transmembrane and cytoplasmic domains. In the Italian patients, the homozygous mutation of the splice donor site probably results in the skipping of exon 3 from the mature mRNA, also leading to a truncated protein. The mutation in the Norwegian family with PLOSL changes the positively charged lysine to asparagine in the transmembrane domain of TREM2. This has been shown to disrupt the association with (McVicar et al. McVicar et al., 1998McVicar DW Taylor LS Gosselin P Willette-Brown J Mikhael AI Geahlen RL Nakamura MC Linnemeyer P Seaman WE Anderson SK Ortaldo JR Mason LH DAP12-mediated signal transduction in natural killer cells: a dominant role for the Syk protein-tyrosine kinase.J Biol Chem. 1998; 273: 32934-32942Crossref PubMed Scopus (182) Google Scholar; Bakker et al. Bakker et al., 1999Bakker ABH Baker E Sutherland GR Phillips JH Lanier LL Myeloid DAP12-associating lectin (MDL)-1 is a cell surface receptor involved in the activation of myeloid cells.Proc Natl Acad Sci USA. 1999; 96: 9792-9796Crossref PubMed Scopus (168) Google Scholar), as well as the cell-surface expression of, TYROBP (Lanier et al. Lanier et al., 1998bLanier LL Corliss B Wu J Phillips JH Association of DAP12 with activating CD94/NKG2C NK cell receptors.Immunity. 1998b; 8: 693-701Abstract Full Text Full Text PDF PubMed Scopus (403) Google Scholar Smith et al. Smith et al., 1998Smith KM Wu J Bakker AB Phillips JH Lanier LL Ly-49D and Ly-49H associates with mouse DAP12 and form activating receptors.J Immunol. 1998; 161: 7-10PubMed Google Scholar). Thus, all these PLOSL mutations are likely to result in complete loss of function of TREM2. The clinical phenotype of these patients with PLOSL was identical with that of those carrying mutations in TYROBP (table 2).Table 2Comparison of PLOSL Manifestations in Patients with Mutations in Either TREM2 or TYROBPTREM2aRoman numerals denote the nationality of the family: I = Italian; II = U.S.; III = Bolivian; IV = Norwegian; V = Swedish. The arabic numerals denote the individual tested. + = present; − = absent; NA = data not available.Symptom(s)I:1I:2II:1III:1IV:1IV:2V:1TYROBPbData are based on reports by Hakola (1972, 1990), Hakola and Partanen (1983), Hakola and Puranen (1993), and Paloneva et al. (2000, 2001).Bones (3rd decade): Skeletal pain−+++++++ Bone cysts or fractures++++++++CNS (4th–5th decades): Frontal-lobe syndromecEuphoria and loss of social inhibitions.++++++++ Progressive dementia++++++++ Other disturbances of higher cortical functionsdAgnostic-aphasic-apraxic symptoms.++−+NA+++ Convulsions+−++eConvulsions appeared after neurosurgery.+NA−+ Primitive reflexes+−++NANA++ Diffuse slowing in the electroencephalogram−+++−NA−+ Brain atrophyfConfirmed by autopsy, computed tomography, or, magnetic-resonance imaging.++++++++a Roman numerals denote the nationality of the family: I = Italian; II = U.S.; III = Bolivian; IV = Norwegian; V = Swedish. The arabic numerals denote the individual tested. + = present; − = absent; NA = data not available.b Data are based on reports by Hakola (Hakola, 1972Hakola HPA Neuropsychiatric and genetic aspects of a new hereditary disease characterized by progressive dementia and lipomembranous polycystic osteodysplasia.Acta Psychiatr Scand. 1972; : 1-173Google Scholar, Hakola, 1990Hakola HPA Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (membranous lipodystrophy): a neuropsychiatric follow-up study.in: Henriksson M Huttunen M Kuoppasalmi K Lindfors O Lönnqvist J Monographs of Psychiatria Fennica. Monograph 17. Foundation for Psychiatric Research in Finland, Helsinki1990: 1-114Google Scholar), Hakola and Partanen (Hakola and Partanen, 1983Hakola HP Partanen VS Neurophysiological findings in the hereditary presenile dementia characterised by polycystic lipomembranous osteodysplasia and sclerosing leukoencephalopathy.J Neurol Neurosurg Psychiatry. 1983; 46: 515-520Crossref PubMed Scopus (18) Google Scholar), Hakola and Puranen (Hakola and Puranen, 1993Hakola HP Puranen M Neuropsychiatric and brain CT findings in polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy.Acta Neurol Scand. 1993; 88: 370-375Crossref PubMed Scopus (23) Google Scholar), and Paloneva et al. (Paloneva et al., 2000Paloneva J Kestila M Wu J Salminen A Bohling T Ruotsalainen V Hakola P Bakker AB Phillips JH Pekkarinen P Lanier LL Timonen T Peltonen L Loss-of-function mutations in TYROBP (DAP12) result in a presenile dementia with bone cysts.Nat Genet. 2000; 25: 357-361Crossref PubMed Scopus (337) Google Scholar, Paloneva et al., 2001Paloneva J Autti T Raininko R Partanen J Salonen O Puranen M Hakola P Haltia M CNS manifestations of Nasu-Hakola disease: a frontal dementia with bone cysts.Neurology. 2001; 56: 1552-1558Crossref PubMed Google Scholar).c Euphoria and loss of social inhibitions.d Agnostic-aphasic-apraxic symptoms.e Convulsions appeared after neurosurgery.f Confirmed by autopsy, computed tomography, or, magnetic-resonance imaging. Open table in a new tab To gain some insight into the peculiar tissue manifestations of PLOSL in the brain and bone, we compared the levels of the TREM2 steady-state transcripts with those of TYROBP in human tissues and cell lines relevant to the clinical phenotype, using northern-blot analyses. In the CNS, the signal-intensity levels of TREM2 transcripts closely followed those of TYROBP, being strongest in the basal ganglia (putamen, caudate nucleus, and substantia nigra), corpus callosum, medulla oblongata, and spinal cord. This would suggest regional coexpression of these two genes encoding interactive proteins in the CNS. In contrast to the strong steady-state mRNA signal intensities of TYROBP in hematological cells and tissues, we detected TREM2 signals only in lymph nodes (fig. 3). The characteristic bone cysts in the patients with PLOSL may reflect chronic dysfunction of osteoclasts. To characterize the expression of TREM2 and TYROBP in bone, we performed quantitative RT-PCR analysis of mRNA in cells differentiating along the osteoclastic lineage. We stimulated monocytes by use of either pseudosynovial fluid obtained from total-hip arthroplasties or a combination of cytokines (comprising macrophage colony–stimulating factor [R&D Systems], receptor activator of NF-κB ligand [Alexis Biochemicals], and interleukin-1β [R&D Systems]). With these inductors, multinuclear tartrate-resistant acid phosphatase– and cathepsin K–positive osteoclastic cells can be generated from peripheral blood monocytes (Kim et al. Kim et al., 2001Kim KJ Kotake S Udagawa N Ida H Ishii M Takei I Kubo T Takagi M Osteoprotegerin inhibits in vitro mouse osteoclast formation induced by joint fluid from failed total hip arthroplasty.J Biomed Mater Res. 2001; 58: 393-400Crossref PubMed Scopus (26) Google Scholar). The relative amount of TYROBP transcripts was ∼200 times higher than that of TREM2, but stimulation increased the expression of both TYROBP and TREM2 (fig. 4). This would suggest that osteoclasts, potentially involved in the pathogenesis of PLOSL, express both TREM2 and TYROBP. TREM2 polypeptide has a structure similar to that of TYROBP-associated TREM1 and LY95, these proteins constituting a superfamily of activating cell-surface receptors (Daws et al. Daws et al., 2001Daws MR Lanier LL Seaman WE Ryan JC Cloning and characterization of a novel mouse myeloid DAP12-associated receptor family.Eur J Immunol. 2001; 31: 783-791Crossref PubMed Scopus (135) Google Scholar). TREM1 is strongly up-regulated in cells that mediate acute inflammatory responses to bacterial infection (i.e., neutrophils and monocytes) (Bouchon et al. Bouchon et al., 2001aBouchon A Facchetti F Weigand MA Colonna M TREM-1 amplifies inflammation and is a crucial mediator of septic shock.Nature. 2001a; 410: 1103-1107Crossref PubMed Scopus (784) Google Scholar), whereas TREM2 is expressed on macrophages and monocyte-derived dendritic cells, suggesting that TREM2 plays a role in chronic, rather than in acute, inflammation (Bouchon et al. Bouchon et al., 2000Bouchon A Dietrich J Colonna M Cutting edge: inflammatory responses can be triggered by TREM-1, a novel receptor expressed on neutrophils and monocytes.J Immunol. 2000; 164: 4991-4995PubMed Google Scholar). This observation would agree well with the late onset and slow progression of PLOSL, which potentially results from chronic inflammation in the CNS and bone. We have identified mutations in all 39 patients with PLOSL who were available to us; 31 (79%) were found to carry a mutation in TYROBP, and 8 (21%) were found to carry a mutation in TREM2. All of our 25 Finnish patients have the same founder mutation in TYROBP, a 5.3-kb deletion encompassing exons 1–4, designated "PLOSLFin" (Paloneva et al. Paloneva et al., 2000Paloneva J Kestila M Wu J Salminen A Bohling T Ruotsalainen V Hakola P Bakker AB Phillips JH Pekkarinen P Lanier LL Timonen T Peltonen L Loss-of-function mutations in TYROBP (DAP12) result in a presenile dementia with bone cysts.Nat Genet. 2000; 25: 357-361Crossref PubMed Scopus (337) Google Scholar). Other patients carrying TYROBP mutations are from Sweden (PLOSLFin, one family) (Paloneva et al. Paloneva et al., 2000Paloneva J Kestila M Wu J Salminen A Bohling T Ruotsalainen V Hakola P Bakker AB Phillips JH Pekkarinen P Lanier LL Timonen T Peltonen L Loss-of-function mutations in TYROBP (DAP12) result in a presenile dementia with bone cysts.Nat Genet. 2000; 25: 357-361Crossref PubMed Scopus (337) Google Scholar), Norway (PLOSLFin, one family) (Paloneva et al. Paloneva et al., 2000Paloneva J Kestila M Wu J Salminen A Bohling T Ruotsalainen V Hakola P Bakker AB Phillips JH Pekkarinen P Lanier LL Timonen T Peltonen L Loss-of-function mutations in TYROBP (DAP12) result in a presenile dementia with bone cysts.Nat Genet. 2000; 25: 357-361Crossref PubMed Scopus (337) Google Scholar; Tranebjærg et al. Tranebjærg et al., 2000Tranebjærg L Schrader H Paloneva J Polycystic lipomembranous osteodysplasia.Tidsskr Nor Laegeforen. 2000; 120: 3196PubMed Google Scholar), Japan (PLOSLJpn, 141delG, one family) (Paloneva et al. Paloneva et al., 2000Paloneva J Kestila M Wu J Salminen A Bohling T Ruotsalainen V Hakola P Bakker AB Phillips JH Pekkarinen P Lanier LL Timonen T Peltonen L Loss-of-function mutations in TYROBP (DAP12) result in a presenile dementia with bone cysts.Nat Genet. 2000; 25: 357-361Crossref PubMed Scopus (337) Google Scholar), and Brazil (a large deletion encompassing exons 1–4, one family) (J.P., unpublished data). Families with mutations in TREM2 originate from the United States, Norway, Sweden, Italy, and Bolivia. The molecular pathogenesis of PLOSL seems to be explained by these two genes. We are aware of one earlier example of a human disease resulting from defects in different components of the same signaling pathway. Autosomally dominant holoprosencephaly results from mutations in genes encoding the signaling molecule, SHH, and its receptor, PTCH, in the sonic hedgehog signaling pathway (Ming et al. Ming et al., 2002Ming JE Kaupas ME Roessler E Brunner HG Golabi M Tekin M Stratton RF Sujansky E Bale SJ Muenke M Mutations in PATCHED-1, the receptor for SONIC HEDGEHOG, are associated with holoprosencephaly.Hum Genet. 2002; 110: 297-301Crossref PubMed Scopus (182) Google Scholar). Interestingly, patients with PLOSL who are homozygous for mutations in either TREM2 or TYROBP display identical CNS and bone manifestations (table 2)—and no immunological symptoms (Paloneva et al. Paloneva et al., 2000Paloneva J Kestila M Wu J Salminen A Bohling T Ruotsalainen V Hakola P Bakker AB Phillips JH Pekkarinen P Lanier LL Timonen T Peltonen L Loss-of-function mutations in TYROBP (DAP12) result in a presenile dementia with bone cysts.Nat Genet. 2000; 25: 357-361Crossref PubMed Scopus (337) Google Scholar). This indicates a remarkable capacity of the human immune system to compensate for the loss of TYROBP-mediated activating signals. Our findings suggest either significant functional redundancy or the presence of additional cell-surface molecules capable of replacing the inactive TYROBP-TREM2 complex in cells of innate immunity. Although we have now identified the signaling pathway responsible for PLOSL, the reason for the peculiar tissue specificity of the symptoms of the patients remains unexplained. The findings in patients with PLOSL should motivate further characterization of the cell- and tissue-specific function of the TREM2-TYROBP signaling complex in the CNS and bone. We thank Elli Kempas for her skillful technical assistance. We also thank Dr. Panu Hakola for his help with the manuscript. This study was supported by the Academy of Finland, the Ulla Hjelt Fond of the Foundation for Pediatric Research, the Helsinki Biomedical Graduate School, the Finnish Cultural Foundation, the Paulo Foundation, and the Finnish Medical Foundation. Erratum et al.The American Journal of Human GeneticsJanuary, 2003In BriefIn the September 2002 issue of the Journal, in the report "Mutations in Two Genes Encoding Different Subunits of a Receptor Signaling Complex Result in an Identical Disease Phenotype," by Paloneva et al. (71:656–662), the nucleotide of the Norwegian TREM2 mutation is incorrect. In the Norwegian family, a 558G→T mutation was found (not 558G→A, as was incorrectly presented in the report). The mutation results in conversion of lysine 186 to asparagine (K186N), and the conversion is correctly presented in the report. Full-Text PDF Open Archive
Support the authors with ResearchCoin
Support the authors with ResearchCoin