The molecular nature of store-operated Ca2+-selective channels has remained an enigma, due largely to the continued inability to convincingly demonstrate Ca2+-selective store-operated currents resulting from exogenous expression of known genes. Recent findings have implicated two proteins, Stim1 and Orai1, as having essential roles in store-operated Ca2+ entry across the plasma membrane. However, transient overexpression of these proteins on their own results in little or no increase in store-operated entry. Here we demonstrate dramatic synergism between these two mediators; co-transfection of HEK293 cells with Stim1 and Orai1 results in an approximate 20-fold increase in store-operated Ca2+ entry and Ca2+-selective current. This demonstrates that these two proteins are limiting for both the signaling and permeation mechanisms for Ca2+-selective store-operated Ca2+ entry. There are three mammalian homologs of Orai1, and in expression experiments they all produced or augmented store-operated Ca2+ entry with efficacies in the order Orai1 > Orai2 > Orai3. Stim1 apparently initiates the signaling process by acting as a Ca2+ sensor in the endoplasmic reticulum. This results in rearrangement of Stim1 within the cell and migration toward the plasma membrane to regulate in some manner Orai1 located in the plasma membrane. However, we demonstrate that Stim1 does not incorporate in the surface membrane, and thus likely regulates or interacts with Orai1 at sites of close apposition between the plasma membrane and an intracellular Stim1-containing organelle. The molecular nature of store-operated Ca2+-selective channels has remained an enigma, due largely to the continued inability to convincingly demonstrate Ca2+-selective store-operated currents resulting from exogenous expression of known genes. Recent findings have implicated two proteins, Stim1 and Orai1, as having essential roles in store-operated Ca2+ entry across the plasma membrane. However, transient overexpression of these proteins on their own results in little or no increase in store-operated entry. Here we demonstrate dramatic synergism between these two mediators; co-transfection of HEK293 cells with Stim1 and Orai1 results in an approximate 20-fold increase in store-operated Ca2+ entry and Ca2+-selective current. This demonstrates that these two proteins are limiting for both the signaling and permeation mechanisms for Ca2+-selective store-operated Ca2+ entry. There are three mammalian homologs of Orai1, and in expression experiments they all produced or augmented store-operated Ca2+ entry with efficacies in the order Orai1 > Orai2 > Orai3. Stim1 apparently initiates the signaling process by acting as a Ca2+ sensor in the endoplasmic reticulum. This results in rearrangement of Stim1 within the cell and migration toward the plasma membrane to regulate in some manner Orai1 located in the plasma membrane. However, we demonstrate that Stim1 does not incorporate in the surface membrane, and thus likely regulates or interacts with Orai1 at sites of close apposition between the plasma membrane and an intracellular Stim1-containing organelle. Store-operated Ca2+ (SOC) 3The abbreviations used are: SOC, store-operated Ca2+; EYFP, enhanced yellow fluorescent protein; DMEM, Dulbecco's modified Eagle's medium; siRNA, small inhibitory RNA; IP3, inositol 1,4,5-trisphosphate; Icrac, calcium-release-activated calcium current; TRP, transient receptor potential; ER, endoplasmic reticulum; HEK, human embryonic kidney; RNAi, RNA interference; PBS, phosphate-buffered saline; FACS, fluorescent-activated cell sorter; GFP, green fluorescent protein. influx is the major mechanism for Ca2+ entry in many non-excitable cell types. Despite more than two decades of research, little is known about the activation mechanism for the channels responsible for this type of Ca2+ entry. Recently, based primarily on RNAi screens from either Drosophila or mammalian cells, two proteins have been identified as essential components in SOC influx: Stim1 (1Roos J. DiGregorio P.J. Yeromin A.V. Ohlsen K. Lioudyno M. Zhang S. Safrina O. Kozak J.A. Wagner S.L. Cahalan M.D. Velicelebi G. Stauderman K.A. J. Cell Biol. 2005; 169: 435-445Crossref PubMed Scopus (1519) Google Scholar, 2Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1753) Google Scholar), and Orai1 (3Feske S. Gwack Y. Prakriya M. Srikanth S. Puppel S.H. Tanasa B. Hogan P.G. Lewis R.S. Daly M. Rao A. Nature. 2006; 441: 179-185Crossref PubMed Scopus (1854) Google Scholar, 4Vig M. Peinelt C. Beck A. Koomoa D.L. Rabah D. Koblan-Huberson M. Kraft S. Turner H. Fleig A. Penner R. Kinet J.P. Science. 2006; 312: 1220-1223Crossref PubMed Scopus (1153) Google Scholar). Stim1 is thought to act as a sensor for Ca2+ in the endoplasmic reticulum, or in that compartment of the endoplasmic reticulum responsible for signaling to store-operated channels. Zhang et al. (5Zhang S.L. Yu Y. Roos J. Kozak J.A. Deerinck T.J. Ellisman M.H. Stauderman K.A. Cahalan M.D. Nature. 2005; 437: 902-905Crossref PubMed Scopus (1134) Google Scholar) proposed a mechanism for Stim1-mediated SOC influx by which Stim1, normally an ER membrane resident protein, is transported to and inserted into the plasma membrane upon Ca2+ store depletion. However, others have suggested that Stim1 may re-localize near the plasma membrane without inserting into the membrane upon Ca2+-store depletion (2Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1753) Google Scholar). Mammalian cells may also express a homolog of Stim1, Stim2 (1Roos J. DiGregorio P.J. Yeromin A.V. Ohlsen K. Lioudyno M. Zhang S. Safrina O. Kozak J.A. Wagner S.L. Cahalan M.D. Velicelebi G. Stauderman K.A. J. Cell Biol. 2005; 169: 435-445Crossref PubMed Scopus (1519) Google Scholar, 2Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1753) Google Scholar, 6Williams R.T. Manji S.S. Parker N.J. Hancock M.S. Van S.L. Eid J.P. Senior P.V. Kazenwadel J.S. Shandala T. Saint R. Smith P.J. Dziadek M.A. Biochem. J. 2001; 357: 673-685Crossref PubMed Scopus (267) Google Scholar), although currently its function in SOC entry is uncertain. Orai1 was first identified by Feske et al. (3Feske S. Gwack Y. Prakriya M. Srikanth S. Puppel S.H. Tanasa B. Hogan P.G. Lewis R.S. Daly M. Rao A. Nature. 2006; 441: 179-185Crossref PubMed Scopus (1854) Google Scholar) through a combined RNAi screen and analysis of gene mutations in patients suffering from severe combined immunodeficiency. The protein appears to be resident in the plasma membrane (3Feske S. Gwack Y. Prakriya M. Srikanth S. Puppel S.H. Tanasa B. Hogan P.G. Lewis R.S. Daly M. Rao A. Nature. 2006; 441: 179-185Crossref PubMed Scopus (1854) Google Scholar, 4Vig M. Peinelt C. Beck A. Koomoa D.L. Rabah D. Koblan-Huberson M. Kraft S. Turner H. Fleig A. Penner R. Kinet J.P. Science. 2006; 312: 1220-1223Crossref PubMed Scopus (1153) Google Scholar), and its molecular function has not yet been defined. However, Vig et al. (4Vig M. Peinelt C. Beck A. Koomoa D.L. Rabah D. Koblan-Huberson M. Kraft S. Turner H. Fleig A. Penner R. Kinet J.P. Science. 2006; 312: 1220-1223Crossref PubMed Scopus (1153) Google Scholar) suggest that Orai1 (which they designated as CRACM1) could function in the plasma membrane either as a component of the calcium release-activated calcium (CRAC) channel, or as a regulator of CRAC channels. In the current study, we have sought to determine if Stim1 and Orai1 functionally interact by co-expressing them in HEK293 cells. Surprisingly, we find that the combination of Stim1 and Orai1 results in a substantial increase in SOC entry, suggesting that these proteins are limiting for, and may actually comprise both the activation as well as permeation mechanism for SOC influx. This is to our knowledge the first demonstration of an Icrac-like current produced by the ectopic expression of known genes. In addition to Orai1, Orai2 expression with Stim1 also enhanced SOC entry in these cells, however to a lesser extent. Although Orai3 alone or with Stim1 showed no elevation in current or Ca2+ entry, it did rescue the knockdown of Orai1 in HEK293 cells. In addition, we have investigated the movements and distribution of Stim1 and conclude that this protein translocates to the vicinity of the plasma membrane, where it presumably interacts with and activates Orai1, but Stim1 does not incorporate into the plasma membrane. Cell Culture—HEK293 cells, obtained from ATCC, were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum and 2 mm glutamine and maintained in a humidified 95% air, 5% CO2 incubator at 37 °C. In preparation for cDNA or siRNA transfection, cells were transferred to 6-well plates and allowed to grow to ∼90% confluence. In preparation for Ca2+ measurements, cells were transferred onto 30-mm round glass coverslips (no. 1 thickness) as a 0.5 ml cell suspension (∼400,000 cells/ml) and allowed to attach for a period of 12 h. Additional DMEM was then added to the coverslip, and the cells maintained in culture for an additional 12-36 h before use in Ca2+ measurements. Plasmids—Full-length Stim1, Orai1, Orai2, and Orai3 cDNA plasmids were purchased from Origene in the pCMV6-XL5 (Stim1 and Orai2) and pCMV-XL4 (Orai1 and Orai3) vectors. The following mutations were made in both the native Stim1 plasmid from Origene as well as Stim1 with the yellow-enhanced fluorescent protein fused to the N terminus, obtained from Tobias Meyer, Stanford University. Single amino acid mutations to the putative EF-hand of Stim1 (D76A, D76N, and E87Q) as well as a multi-amino acid mutant (D76N/D78N) were made by site-directed mutagenesis with the QuikChange site-directed mutagenesis kit (Stratagene). The mutations were all sequence-confirmed. The KIR-GFP plasmid was obtained from Deborah Burshtyn, University of Alberta. siRNA Knockdown—HEK293 cells were plated in a 6-well plate on day 1. On day 2, cells were transfected with siRNA (100 nm) against Stim1 (Dharmacon) or Orai1 (Invitrogen) using Metafectene (Biontex Laboratories GmbH, Martinsried/Planegg, Germany, 7 μl per well), and including siGLO (Dharmacon) as a marker. The sequence of the siRNA against Stim1 was: agaaggagcuagaaucucac; for Orai1 it was: cccuucggccugaucuuuaucgucu. After a 6-h incubation period, the medium bathing the cells was replaced with complete DMEM and maintained in culture. On day 3, siRNA treated cells were transfected with cDNA for Stim1 tagged with EYFP, or EYFP alone, as described below. On day 4, cells were transferred to 30-mm glass coverslips in preparation for Ca2+ measurements as described above, which were performed on day 5 or 6. cDNA Transfection—HEK293 cells were plated in a 6-well plate on day 1. On day 2, cells were transfected using Lipofectamine 2000 (Invitrogen; 2 μl per well) with cDNA (0.5 μg/well) for EYFP, Orai1, Orai2, Orai3, or EYFP tagged Stim1 (a gift from Dr. Tobias Meyer) and mutant forms of Stim1. The latter constructs have a mutation in the putative EF-Hand region of the Stim1 molecule (described under “Results”). After a 6-h incubation period, the medium bathing the cells was replaced with complete DMEM and maintained in culture. On day 3, cDNA treated cells were transferred to 30-mm glass coverslips in preparation for Ca2+ measurements as described above, which were performed on day 4 or 5. In general, the concentration of plasmid used was 0.5 μg/well, except for EYFP (0.1 μg/well) Higher concentrations of plasmid (2.0 μg/well) were used in some of the experiments with Orai2 and 3, as indicated under “Results.” Single Cell Ca2+ Measurements—Fluorescence measurements were made in HEK293 cells loaded with the Ca2+-sensitive dye, fura-5F, as described previously (2Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1753) Google Scholar). Briefly, cells plated on 30-mm round coverslips and mounted in a Teflon chamber were incubated in DMEM with 1 μm acetoxymethyl ester of fura-5F (fura-5F/AM, Molecular Probes) at 37 °C in the dark for 25 min. For [Ca2+]i measurements, cells were bathed in HEPES-buffered salt solution (HBSS: NaCl 120; KCl 5.4; Mg2SO4 0.8; HEPES 20; CaCl2 1.8; and glucose 10 mm, with pH 7.4 adjusted by NaOH) at room temperature. Nominally Ca2+- free solutions were HBSS with no added CaCl2. Fluorescence images of the cells were recorded and analyzed with a digital fluorescence imaging system (InCyt Im2, Intracellular Imaging Inc., Cincinnati, OH). Changes in intracellular Ca2+ are represented by and expressed as the ratio of fura-5F fluorescence because of excitation at 340 nm and 380 nm (F340/F380). Before starting the experiment, regions of interests identifying transfected cells expressing the EYFP fluorescence tag were created by observing cells at a 530-nm emission wavelength and illuminated with 477-nm excitation light. Typically, 20 to 30 cells were monitored per experiment. In all cases, ratio values have been corrected for contributions by autofluorescence, which is measured after treating cells with 10 μm ionomycin and 20 mm MnCl2. Electrophysiology—Whole cell currents were investigated at room temperature (20-25 °C) in HEK293 cells using the patch clamp technique in the whole cell configuration. The standard extracellular recording solution contained (mm): 140 NaCl, 3 mm KCl, 1.2 MgCl2, 0 -10 mm CaCl2, 10 glucose, and 10 HEPES (pH to 7.4 with NaOH). Divalent-free solution (DVF) contained the same as above, except Ca2+ and Mg2+ were eliminated and 0.1 mm EGTA was added. Nominally Ca2+ free (NCF) external solution was also the same as above, except no Ca2+ was added. Fire-polished pipettes fabricated from borosilicate glass capillaries (WPI, Sarasota, FL) with 3-5 MΩ resistance were filled with (in mm): 145 cesium methanesulfonate, 10 BAPTA, 10 HEPES, and 8 MgCl2 (pH to 7.2 with CsOH). In some experiments, 100 μm inositol 1,4,5-trisphosphate (IP3) was directly added to the intracellular pipette solution, and 1 μm gadolinium (Gd3+) or 30 μm 2-aminoethoxydiphenylborane (2APB) was added to the extracellular recording solution. External solution changes were made using a multibarrel perfusion pencil (Automate Scientific) placed adjacent to the cell under investigation. Voltage ramps (-100 mV to +100 mV) of 250 ms were recorded every 2 s immediately after gaining access to the cell, and the currents were normalized based on cell capacitance (mean = 14.4 ± 1.2 pF). Leak currents were subtracted by taking an initial ramp current before the store-operated currents developed and subtracting this from all subsequent ramp currents. Access resistance was typically between 5 and 10 MΩ. The currents were acquired using pCLAMP-9.2 (Axon Instruments) and analyzed using Clampfit (Axon Instruments) and Origin 6 (Microcal) software. Confocal Microscopy—For experiments examining the intracellular distribution of Stim1, HEK293 cells, expressing EYFP-Stim1 or EYFP-Stim1 EF hand mutants, were prepared for confocal microscopy in a similar way as described for Ca2+ measurements. Cells plated on 30-mm round coverslips and mounted in a Teflon chamber were placed on the stage of a Zeiss LSM 510 confocal microscope equipped with a 40× water immersion objective (N.A. 1.2). Images of EYFP were obtained with 488-nm excitation light from an argon ion Laser (Lasos T812 M24), and emission fluorescence selected with a 505-550-nm bandpass filter. Confocal images were collected with a pinhole set at 1 Airy unit (∼0.9-μm image thickness). For experiments examining surface expression of Stim1, HEK293 cells that had been transfected with cDNA encoding EYFP-Stim1, EYFP-Stim1-D76A, or EYFP-Stim1 in combination with Orai1 were plated onto glass coverslips and allowed to attach overnight. Cells were washed with Ca2+- free PBS prior to addition of either PBS containing 1.8 mm CaCl2 or Ca2+ -free PBS with 2 μm thapsigargin. Following a 15-min incubation period, cells were fixed by the addition of paraformaldehyde to a final concentration of 1.6%. Cells were incubated 10 min at room temperature and then washed with FACS buffer. Permeabilized cells were washed once for 3 min with FACS buffer supplemented with 0.1% Triton X-100, followed by additional washes with FACS buffer to remove residual detergent. Cells were then stained with anti-EYFP antibody conjugated to Alexa 647 (Molecular Probes, Eugene, OR). Following three wash steps, coverslips were mounted onto slides using ProLong Gold Anti-fade mounting reagent (Molecular Probes). The mounting agent was allowed to set overnight prior to analysis on a Zeiss LSM 510 UV Meta confocal microscope. Background for antibody staining was determined by setting the gain setting just below the point where fluorescence in the 647-nm channel was visible in HEK293 cells transfected with EYFP cDNA. For intact, EYFP-Stim1-transfected samples, the gain was left at this level throughout the analysis. For permeabilized samples, the gain was adjusted downward until the image was just below the saturation point for all pixels. Total Internal Reflection Fluorescence Microscopy (TIRFM)—TIRFM was carried out using an Olympus (Melville, NY) IX2-RFAEVA-2 illumination system mounted on an Olympus IX71 inverted microscope as previously described (7Smyth J.T. Lemonnier L. Vazquez G. Bird G.S. Putney Jr., J.W. J. Biol. Chem. 2005; 281: 11712-11720Abstract Full Text Full Text PDF Scopus (58) Google Scholar). Illumination was provided by a 488-nm argon ion laser (Melles Griot, Carlsbad, CA) directed through a fiber optic cable, and emitted fluorescence passed through a D525/50m filter (Chroma) before being captured by a Photometrics Cascade 512F cooled CCD (Roper Scientific, Tucson, AZ). Laser illumination was not toxic to cells, because HEK293 cells loaded with the Ca2+ dye Fluo-3 did not exhibit aberrant Ca2+ release or signs of degeneration when monitored with this system (data not shown). Materials—Thapsigargin was purchased from Alexis (San Diego, CA), fura-5F/AM from Molecular Probes. Co-expression of Stim1 and Orai1 Results in a Synergistic and Robust Increase in SOC Entry—Fig. 1 shows the results of experiments in which HEK293 cells were transiently transfected with EYFP-Stim1, Orai1, or both. Successfully transfected cells were identified by the fluorescence from EYFP-Stim1, or by co-transfected EYFP for control cells or cells transfected only with Orai1. SOC entry was assessed by examining the magnitude of the [Ca2+]i signal upon reintroduction of Ca2+ to cells previously treated with the sarcoplasmic-endoplasmic reticulum ATPase inhibitor, thapsigargin, in the absence of extracellular Ca2+. Graded additions of extracellular Ca2+ resulted in a graded elevation in [Ca2+]i. Overexpression of EYFP-Stim1 had little if any effect on Ca2+ entry assessed in this way. Surprisingly, overexpression of Orai1 significantly inhibited SOC entry. More importantly, co-expression of both EYFP-Stim1 with Orai1 resulted in a substantial increase in store-operated Ca2+ entry (Fig. 1). Similar synergism between expression of Stim1 and Orai1 was observed in experiments utilizing Ba2+ as a surrogate for Ca2+ (not shown). The large Ca2+ entry resulting from co-expression of EYFP-Stim1 and Orai1 was blocked by 1 μm Gd3+ or 30 μm 2APB, which is the expected pharmacological profile of store-operated channels (8Putney Jr., J.W. Mol. Interventions. 2001; 1: 84-94PubMed Google Scholar). Finally, co-expression of Stim2 with Orai1 resulted in responses resembling those with Orai1 alone, i.e. inhibition of entry (not shown). We examined whole cell currents in HEK293 cells transfected with these same constructs. In our hands, wild-type HEK293 cells do not reproducibly show detectable store-operated currents, and in other laboratories, these currents have been described as very small and are inconsistently detectable (4Vig M. Peinelt C. Beck A. Koomoa D.L. Rabah D. Koblan-Huberson M. Kraft S. Turner H. Fleig A. Penner R. Kinet J.P. Science. 2006; 312: 1220-1223Crossref PubMed Scopus (1153) Google Scholar, 9Bugaj V. Alexeenko V. Zubov A. Glushankova L. Nikolaev A. Wang Z. Kaznacheyeva E. Bezprozvanny I. Mozhayeva G.N. J. Biol. Chem. 2005; 280: 16790-16797Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar, 10Fasolato C. Nilius B. Pflüg. Arch. 1998; 436: 69-74Crossref PubMed Scopus (96) Google Scholar). When we broke into HEK293 cells with pipettes containing 10 mm BAPTA and 100 μm IP3, we saw no consistent development of current in control cells (Fig. 2A) or in cells transfected with either EYFP-Stim1 (not shown) or Orai1 alone. However, in cells co-transfected with EYFP-Stim1 and Orai1, we observed very large inward currents, of the order of 300 -500 pA with 10 mm Ca2+ outside (Fig. 2, A and B). The currents developed rapidly with BAPTA and IP3 in the pipette (Fig. 2A), and after a delay when stores were depleted passively with BAPTA alone (Fig. 2B). These currents showed strong inward rectification and reversed at +50 mV, as expected for a calcium-selective channel (Fig. 2C). The current was fully blocked by 1 μm Gd3+ (Fig. 2), which at this concentration is believed to block only store-operated channels (11Broad L.M. Cannon T.R. Taylor C.W. J. Physiol. (Lond. 1999; 517: 121-134Crossref Scopus (195) Google Scholar, 12Luo D. Broad L.M. Bird G.S. Putney Jr., J.W. J. Biol. Chem. 2001; 276: 20186-20189Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar). A hallmark of Icrac is that rapid removal of extracellular divalent cations causes a transient increase in current due to initial removal of Ca2+ block (13Hoth M. Penner R. J. Physiol. (Lond.). 1993; 465: 359-386Crossref Scopus (661) Google Scholar) followed by a process of depotentiation involving loss of Ca2+ from external modulatory sites (14Zweifach A. Lewis R.S. J. Gen. Physiol. 1996; 107: 597-610Crossref PubMed Scopus (127) Google Scholar). As shown in Fig. 2D, the large currents observed in Orai1 + Stim1 expressing cells showed similar behavior upon removal of extracellular divalent cations. Finally, the IP3-activated current was transiently augmented by 5 μm 2APB and was completely blocked by 30 μm of this drug, which is a pharmacological hallmark of Icrac (15Prakriya M. Lewis R.S. J. Physiol. (Lond. 2001; 536: 3-19Crossref Scopus (428) Google Scholar) (Fig. 2E). Although we did not consistently observe store-operated currents in our untransfected HEK293 cells, based on the value reported by Vig et al. (4Vig M. Peinelt C. Beck A. Koomoa D.L. Rabah D. Koblan-Huberson M. Kraft S. Turner H. Fleig A. Penner R. Kinet J.P. Science. 2006; 312: 1220-1223Crossref PubMed Scopus (1153) Google Scholar) of 0.5 pA/pF, the large Icrac-like currents observed with co-expression of Stim1 and Orai1 suggest an increase in current density of at least a factor of 20. Effects of Expression of Orai2 and Orai3—In addition to Orai1, mammalian cells express two additional homologous genes, Orai2 and Orai3 (3Feske S. Gwack Y. Prakriya M. Srikanth S. Puppel S.H. Tanasa B. Hogan P.G. Lewis R.S. Daly M. Rao A. Nature. 2006; 441: 179-185Crossref PubMed Scopus (1854) Google Scholar). To determine if these genes also encoded components of an Icrac-like entry mechanism, we co-expressed each of these with Stim1 in the same manner as for Orai1. With this protocol, Orai2, like Orai1, inhibits Ca2+ entry on its own, and substantially augments thapsigargin-activated Ca2+ entry when co-expressed with Stim1 (Fig. 3, A and B); however, the increase in [Ca2+]i was consistently less than seen in the Orai1 experiments (Orai1 data are included in Fig. 3A for comparison). As for Orai1, this entry is blocked by 1 μm Gd3+ or 30 μm 2APB (Fig. 3, C and D). In the experiments in Fig. 3A, cells were transfected with 0.5 μg/well of the Orai2 containing plasmid, a similar concentration to that used for Orai1 experiments. In patch-clamp experiments, we found that currents were inconsistently observed with cells transfected in this manner. We thus increased the concentration of Orai2 plasmid to 2.0 μg/well, which resulted in larger [Ca2+]i increases (this is actually the concentration used for experiments in Fig. 3C) and consistently observed Icrac- like currents. Fig. 4 shows that overexpression of Orai2 and Stim1 results in currents somewhat smaller than for Orai1, although with similar properties. The currents were transiently increased in divalent-free solutions, and subsequently underwent depotentiation (Fig. 4B). The IV relationships for the Orai2 + Stim1 currents showed strong inward rectification, typical of Icrac-like currents (Fig. 4C). No such currents were observed following transfection with Orai2 alone (not shown). Expression of Orai3 alone failed to suppress SOC entry (not shown) and co-expression of Stim1 and Orai3 failed to produce increased thapsigargin-induced Ca2+ entry, or store-operated currents, even with 2.0 μg/well of plasmid (Fig. 5, A and B). The failure of Orai3 could mean that this particular protein has some function other than regulation or mediation of Ca2+ entry. Alternatively, it could be poorly expressed, or only function in conjunction with other players, for example in complexes with other Orai family members. However, because Orai3 alone did not suppress Ca2+ entry, we were able to obtain evidence that Orai3 can function in store-operated Ca2+ entry in RNAi rescue experiments. As shown in Fig. 5, C and D, knockdown of Orai1 by RNAi results in substantial abrogation of thapsigargin-activated Ca2+ entry, in confirmation of previous reports (3Feske S. Gwack Y. Prakriya M. Srikanth S. Puppel S.H. Tanasa B. Hogan P.G. Lewis R.S. Daly M. Rao A. Nature. 2006; 441: 179-185Crossref PubMed Scopus (1854) Google Scholar, 4Vig M. Peinelt C. Beck A. Koomoa D.L. Rabah D. Koblan-Huberson M. Kraft S. Turner H. Fleig A. Penner R. Kinet J.P. Science. 2006; 312: 1220-1223Crossref PubMed Scopus (1153) Google Scholar, 16Zhang S.L. Yeromin A.V. Zhang X.H. Yu Y. Safrina O. Penna A. Roos J. Stauderman K.A. Cahalan M.D. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 9357-9362Crossref PubMed Scopus (745) Google Scholar). When we expressed Orai3 in cells following Orai1 knockdown, thapsigargin-activated Ca2+ entry was essentially restored to the control level (Fig. 5, C and D). We still did not see significant Ca2+ currents in these cells, consistent with the idea that entry was returned only to the control level. The ability of Orai3 to rescue Ca2+ entry following knockdown of Orai1 may indicate that Orai3 is expressed at a more modest (perhaps physiological) level than Orai1, or that it can function together with limited remaining Orai1. Additional experiments will be needed to distinguish among these, or other possibilities. Nonetheless, the clear augmentation of entry by Orai3 in this particular situation demonstrates that this gene product can also play a role in the generation or regulation of store-operated Ca2+ entry. In summary, we find that in expression experiments, all three Orai genes can generate or augment store-operated Ca2+ entry with efficacies in the order Orai1 > Orai2 > Orai3. How this apparent rank order relates to their function under conditions of physiological expression will require additional study. Stim1 Movements in Response to Ca2+ Store Depletion—We next sought to address the question of how Stim1 might regulate the complex leading to channel activation. Two ideas have been suggested; according to Liou et al. (2Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1753) Google Scholar), Stim1 redistributes within the cell, approaching the plasma membrane, but does not incorporate into the plasma membrane. A contrasting idea put forth by Zhang et al. (5Zhang S.L. Yu Y. Roos J. Kozak J.A. Deerinck T.J. Ellisman M.H. Stauderman K.A. Cahalan M.D. Nature. 2005; 437: 902-905Crossref PubMed Scopus (1134) Google Scholar) suggests that Stim1 actually traffics to, and is incorporated into the plasma membrane where it interacts with key players in the store-operated Ca2+ entry pathway. Also, Spassova et al. (17Spassova M. Soboloff J. He L.-P. Xu W. Dziadek M. Gill D.L. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 4040-4045Crossref PubMed Scopus (277) Google Scholar) presented evidence for a role of plasma membrane Stim1, but did not address the question of whether Stim1 moves into the plasma membrane upon store depletion, or is present there constitutively. By use of total internal reflected fluorescence (TIRF) microscopy with HEK293 cells transfected with EYFP-Stim1, we confirmed the observation made by Zhang et al. (5Zhang S.L. Yu Y. Roos J. Kozak J.A. Deerinck T.J. Ellisman M.H. Stauderman K.A. Cahalan M.D. Nature. 2005; 437: 902-905Crossref PubMed Scopus (1134) Google Scholar) and by Liou et al. (2Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1753) Google Scholar) that Stim1 does move to the vicinity of the plasma membrane following depletion of Ca2+ stores with thapsigargin (Fig. 6A). We also carried out confocal imaging studies with this construct; consistent with previous findings (2Liou J. Kim M.L. Heo W.D. Jones J.T. Myers J.W. Ferrell Jr., J.E. Meyer T. Curr. Biol. 2005; 15: 1235-1241Abstract Full Text Full Text PDF PubMed Scopus (1753) Google Scholar), EYFP-Stim1 reorganizes from an apparent fibrillar or tubular form into discrete punctae in response to depletion of Ca2+ stores with thapsigargin (Fig. 6B). We prepared sever
